Calymma communimacula

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Calymma

At a glance

Occurrence records421

Data sources9

Biological traits0

DNA specimens6

eDNA detections1

Sources9 archives

Databases and archives Calymma communimacula's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility421 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF421 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD6 specimens

Genome at a glanceGoaT · NCBI≈570 Mbp

01Narrative

Calymma is a monotypic moth genus of the family Erebidae erected by Jacob Hübner in 1823. Its single species, Calymma communimacula, was first described by Michael Denis and Ignaz Schiffermüller in 1775."Calymma communimacula (Denis & Schiffermüller, 1775)". Fauna Europaea. Retrieved 17 November 2019. It is found in central and southern Europe and from Turkey to Transcaucasia and the Middle East. The wingspan is 18–24 mm. Adults are on wing from July to August. The larvae live on trees, but do not feed on plant material, but suck dry Coccoidea (scale insects) and use the empty hulls as a protective shelter. Pupation takes place in a spinning on the tree trunk.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calymma communimacula has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACCTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCATTAAGATTACTAATTCGAGCTGAATTAGGTAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eublemma innocenssame family6.4%Cardepia affinissame order6.4%Eublemma reductasame family6.5%Zanclognatha pedipilalissame family6.7%Zanclognatha marthasame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Calymma communimacula carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈569 573 044 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Calymma communimacula0.57 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.5% BUSCO

08Occurrence & distribution

Record type421 records

Wild obs. + sensor302

Museum / vouchered35

Other84

Range

Area of Occupancy AOO860 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 67≤1 km 32≤10 km 73>10 km 11

183 georeferenced · 119 without coordinates

Open the mapobservation + sensor302

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤1 km 23≤10 km 4

27 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Provincia di Livornolocation not on record	26
Tiroler Landesmuseum Ferdinandeumlocation not on record	1

2 institutions · 27 of 35 vouchered records shown · 8 without an institution code

09Environmental DNA1 detections

Where the DNA of Calymma communimacula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.8 °C 21.8–21.8

Seasonal swing summer↔winter21.6 °C

Max temp (day)26.2 °C

Min temp (night)16.8 °C

Precipitation64.3 mm/mo

Air humidity55.3 %

Moisture balance-89.7 mm/mo

Vapour deficit1,165 Pa

Wind speed3.60 m/s

Cloud cover36.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)