Caloptilia alchimiella

(Scopoli, 1763) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gracillariidae/Caloptilia

At a glance

Occurrence records5 096

Data sources7

Biological traits2

DNA specimens81

eDNA detections117

Sources7 archives

Databases and archives Caloptilia alchimiella's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 096 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI117 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics81 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF5 096 records

Environmental DNA3 datasets · 17 countries117 detections

DNA & barcodingBOLD81 specimens

01Narrative

Caloptilia alchimiella (commonly known as yellow-triangle slender) is a moth of the family Gracillariidae. It is found in Europe and the Near East. Oak leaves rolled into a conical form by the larva Larva The wingspan is 10 -. Forewings purplish - ferruginous ; dorsum suffused with yellow towards base ; a large triangular yellow median costal blotch, apex often rounded. Hindwings dark grey. .Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description The moth flies from May to July depending on the location. The larvae feed on Quercus species, Castanea sativa and Fagus sylvatica.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding81 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Caloptilia alchimiella has left across the world's sequence archives.

At a glance

DNA specimens81

BINs1

Marker genes2

eDNA detections117

Countries17

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus63 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

92Cvariable

100Amostly conserved

190Amostly conserved

202Cmostly conserved

220Gmostly conserved

238Tmostly conserved

262Gvariable

271Tmostly conserved

466Gmostly conserved

475Tmostly conserved

511Gvariable

553Amostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCTGGTATATTAGGAACTTCTTTAAGAATATTAATTCGAGCAGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.73%

Haplotypes11

BIN1

Most divergent pair2.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Caloptilia sapporellasame genus4.3%Caloptilia robustellasame genus4.9%Caloptilia semifasciellasame genus6.4%Caloptilia conimbricensissame genus6.4%Caloptilia invariabilissame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PH3

animal barcodemarker

08Occurrence & distribution

Record type5 096 records

Wild obs. + sensor4 342

Museum / vouchered716

Other38

Origin

Native10

Range

Area of Occupancy AOO7 480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 1 691≤1 km 712≤10 km 1 567>10 km 4

3 974 georeferenced · 368 without coordinates

Open the mapobservation + sensor4 342

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 198≤1 km 235≤10 km 91>10 km 1

525 georeferenced · 191 without coordinates

Open the institutions mapphysical evidence716

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	176
NHMOlocation not on record	68
Provincia di Livornolocation not on record	62
SLU Artdatabankenlocation not on record	48
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	48
Tartu, EE	47
Nijmegen, NL	36
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	20
Stockholm, SE	19
DABUHlocation not on record	18
Salzburg, AT	16
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	16
Tilburg, NL	15
Natural History Museum Rotterdamlocation not on record	14
South Kensington, GB	11
Uniwersytet Łódzkilocation not on record	4
Kuopio, FI	4
ZSMlocation not on record	3
European Distributed Institute of Taxonomy (EDIT)location not on record	2
Helsinki, FI	2
Tallinn, EE	2
Bavarian State Collection of Zoologylocation not on record	2
Rovaniemi, FI	1
Research Collection of Hartmut Wegnerlocation not on record	1
Natural History Museum, Londonlocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
University of Kaiserslauternlocation not on record	1
Research Collection of Thomas Guggemooslocation not on record	1
ZMAAlocation not on record	1

29 institutions · 640 of 716 vouchered records shown · 76 without an institution code

09Environmental DNA117 detections

Where the DNA of Caloptilia alchimiella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found117

Studies independent surveys3

Countries17

Verifiable raw sequence linked40

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 117 detections have coordinates

Open the map17 countries0

1.1. Boreal Forest|1. Forest & Woodlandmixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 10.9–19.4

Seasonal swing summer↔winter18.3 °C

Max temp (day)18.6 °C 14.2–24.2

Min temp (night)10.4 °C 5.90–14.9

Precipitation71.9 mm/mo 44.8–110

Air humidity59.2 % 56.3–62.1

Moisture balance-38.0 mm/mo -88.0–14.4

Vapour deficit667 Pa 499–990

Wind speed3.20 m/s 2.10–4.10

Cloud cover39.2 % 33.9–49.5

CHELSA 1981–2010, ~9 km grid, at location & month of 116 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Caloptilia alchimiella

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type5 096 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 096 records