Calochortus pulchellus

(Benth.) Alph.Wood · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Calochortus

At a glance

Occurrence records2 187

Data sources8

Biological traits15

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Calochortus pulchellus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 187 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF2 187 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

Calochortus pulchellus là một loài thực vật có hoa trong họ Liliaceae. Loài này được (Benth.) Alph.Wood miêu tả khoa học đầu tiên năm 1868.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass3.9 mg

Seed mass max3.9 mg

Seed mass min3.9 mg

Life cycle & reproduction4

Life formbulbous geophyte

Life spanperennial

Lifespan years49.17 years

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calochortus pulchellus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLKM085560.1 ↗1 226 bp

ACGT

TATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCGGAAGAGGCAGGG …

Calochortus pulchellus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Calochortus pulchellus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 204×CCDB · eflora · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · eflora

CCDB · book-fedorov — BUitell (Cave 1941)

CCDB · book-fedorov — Beal. Ownbey

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.072 ↗

08Occurrence & distribution

Record type2 187 records

Wild obs. + sensor2 148

Museum / vouchered39

Range

Area of Occupancy AOO1 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤1 km 1≤10 km 42>10 km 2 105

2 148 georeferenced

Open the mapobservation + sensor2 148

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤1 km 5≤10 km 19

24 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ashland, US	4
Davis, US	4
Arcata, US	2
Moscow, US	1
Los Angeles, US	1
Madison, US	1
Santa Barbara, US	1
South Kensington, GB	1
Provo, US	1
Northridge, US	1
Chadron, US	1

11 institutions · 18 of 39 vouchered records shown · 21 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Calochortus pulchellus

At a glance

Sources8 archives

Size & morphology3

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 187 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 11 geolocated

Record type2 187 records