Calochortus macrocarpus

Douglas · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Calochortus

At a glance

Occurrence records4 388

Data sources11

Biological traits90

DNA specimens4

eDNA detections2

Sources11 archives

Databases and archives Calochortus macrocarpus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 388 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources90 traits

Occurrence & distributionGBIF4 388 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · NCBI≈1.6 Gbp

01Narrative

Calochortus macrocarpus, also known as sagebrush mariposa lily, is a North American species of bulbous perennials in the lily family.Douglas, David 1828. Transactions of the Horticultural Society of London 7(2): 276–277, plate 8Gerritsen, M.E. & Parsons, R. (2007). Calochortus: Mariposa lilies & their relatives: 1-232. Timber press, Inc. Portland, U.S.A..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height0.55 m

Seed mass2.24 mg

Seed mass max2.24 mg

Seed mass min2.24 mg

Life cycle & reproduction24

Bloom periodMid Summer

Coppice potentialNo

Flower colourpurple

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endSummer

Growth rate USDAModerate

Life formbulbous geophyte

Life spanperennial

Lifespan categoryModerate

Propagated by bare rootNo

Propagated by bulbYes

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Raunkiær life formcryptophyte

Resprout abilityNo

Seed spread rateSlow

Seedling vigorLow

Vegetative spread rateSlow

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSummer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureFine

Fruit colourbrown

Growth formherb

Growth form USDASingle Crown

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min8 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry19

Anaerobic toleranceNone

C:N ratioLow

Caco3 toleranceLow

Cold stratification requiredYes

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceMedium

Frost free days min140 days

Moisture useLow

Nitrogen fixation levelNone

Photosynthetic pathwayC3

Precipitation max16 in

Precipitation min7 in

Salinity toleranceLow

Shade toleranceHigh

Soil pH max7 pH

Soil pH min5.7 pH

Temperature min-23 °F

Uses & economy12

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityContracting Only

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable humanNo

Post productNo

Pulpwood productNo

ToxicityNone

Veneer productNo

Other traits6

Fall conspicuousNo

Fruit seed abundanceLow

Fruit seed conspicuousNo

Fruit seed persistenceNo

Planting density max11 000 per acre

Planting density min4 800 per acre

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calochortus macrocarpus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences6

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKX679086.1 ↗552 bpCanada · 2010

ACGT

AGTGCTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Calochortus macrocarpus voucher ERM311 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★rbcLa

plant barcode

06Genome at a glanceCCDB · NCBI

The complete instruction manual Calochortus macrocarpus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 623 494 236 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Calochortus macrocarpus1.62 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–402n range14median14mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 144×CCDB · eflora · CCDB · book-fedorov

CCDB · eflora

CCDB · book-fedorov — Beal 1939

CCDB · book-fedorov — Beal, Ownbey 1943

CCDB · book-fedorov — Baal 1939

2n 401×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.998 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type4 388 records

Wild obs. + sensor4 060

Museum / vouchered328

Origin

Native9

Range

Area of Occupancy AOO7 852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 2 595≤1 km 343≤10 km 170>10 km 162

3 270 georeferenced · 790 without coordinates

Open the mapobservation + sensor4 060

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 20≤1 km 61≤10 km 85>10 km 5

171 georeferenced · 157 without coordinates

Open the institutions mapphysical evidence328

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	78
Vancouver, CA	42
Moscow, US	35
Bronx, US	19
CASlocation not on record	16
Caldwell, US	14
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	13
Missoula, US	11
Victoria, CA	10
Boise, US	8
Tacoma, US	7
Ashland, US	6
Chongqing Museumlocation not on record	6
Chapel Hill, US	5
VALElocation not on record	4
Bozeman, US	3
Cheney, US	3
Bend, US	3
University of Stellenboschlocation not on record	3
Pocatello, US	3
Austin, US	2
University of British Columbia, Herbariumlocation not on record	2
Madison, US	2
Whitehorse, CA	2
Bangkok, TH	2
Provo, US	2
Pullman, US	2
Northridge, US	1
Corvallis, US	1
Canadian Department of Agriculturelocation not on record	1
Logan, US	1
Oskarshamn, SE	1
Arcata, US	1
Tampa, US	1
Denver, US	1
Phoenix, US	1
Mississippi State, US	1
Severin-McDaniel Insect Collectionlocation not on record	1
Angwin, US	1

39 institutions · 315 of 328 vouchered records shown · 13 without an institution code

09Environmental DNA2 detections

Where the DNA of Calochortus macrocarpus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 17.4–17.4

Seasonal swing summer↔winter24.4 °C

Max temp (day)23.1 °C 22.8–23.3

Min temp (night)11.5 °C 11.0–12.0

Precipitation55.5 mm/mo 46.3–64.8

Air humidity52.8 % 52.3–53.4

Moisture balance-78.7 mm/mo -83.6–-73.7

Vapour deficit944 Pa 935–954

Wind speed1.60 m/s 1.50–1.80

Cloud cover37.4 % 35.2–39.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Calochortus macrocarpus

At a glance

Sources11 archives

Size & morphology4

Life cycle & reproduction24

Diet & foraging1

Habitat & environment24

Physiology & chemistry19

Uses & economy12

Other traits6

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type4 388 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions30 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 388 records