Calochortus luteus

Douglas ex Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Calochortus

At a glance

Occurrence records7 121

Data sources9

Biological traits20

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Calochortus luteus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 121 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF7 121 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · NCBI≈2.1 Gbp

01Narrative

Calochortus luteus là một loài thực vật có hoa trong họ Liliaceae. Loài này được Douglas ex Lindl. miêu tả khoa học đầu tiên năm 1833.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.12 mg

Seed mass max1.59 mg

Seed mass min0.66 mg

Life cycle & reproduction4

Dispersal typeunspecialized

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry6

Leaf C:N ratio40.23 g/g

Leaf c422 mg/g

Leaf dry-matter content (LDMC)182 mg/g

Leaf n10.5 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)25.49 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calochortus luteus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM085554.1 ↗1 226 bp

ACGT

TATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCGGAAGAGGCAGGG …

Calochortus luteus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3

plant barcode

06Genome at a glanceCCDB · NCBI

The complete instruction manual Calochortus luteus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈2 067 371 254 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Calochortus luteus2.07 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 71×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — CAVE, M.S. 1970. Chromosomes of California Liliaceae. Univ. Calif. Publ. Bot. 57: 1-58.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.999 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type7 121 records

Wild obs. + sensor6 674

Museum / vouchered445

Cultivated / captive1

Fossil1

Origin

Native1

Introduced1

Range

Area of Occupancy AOO5 776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 4 104≤1 km 551≤10 km 285>10 km 245

5 185 georeferenced · 1 489 without coordinates

Open the mapobservation + sensor6 674

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 14≤1 km 138≤10 km 101>10 km 6

259 georeferenced · 186 without coordinates

Open the institutions mapphysical evidence445

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	53
Davis, US	50
Pullman, US	37
Santa Barbara, US	33
Angwin, US	27
Arcata, US	15
San Luis Obispo, US	13
Turlock, US	13
Claremont, US	11
Riverside, US	10
Canadian Department of Agriculturelocation not on record	10
Santa Cruz, US	7
Ashland, US	7
US	7
San Diego, US	6
CASlocation not on record	6
Fredericton Stock Culture Collectionlocation not on record	5
Long Beach, US	4
Northridge, US	4
University of Stellenboschlocation not on record	3
South Kensington, GB	3
Bronx, US	3
Chongqing Museumlocation not on record	2
Chapel Hill, US	2
Madison, US	2
Logan, US	1
Tampa, US	1
Boise, US	1
Nantes Culture Collectionlocation not on record	1
Auckland, NZ	1
Moscow, US	1
Irvine, US	1
Provo, US	1
San Jose, US	1
Bloomington, US	1
Macomb, US	1

36 institutions · 344 of 445 vouchered records shown · 101 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Calochortus luteus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Calochortus luteus

At a glance

Sources9 archives

Size & morphology3

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry6

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type7 121 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions29 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type7 121 records