Calochortus leichtlinii

Hook.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Calochortus

At a glance

Occurrence records4 907

Data sources11

Biological traits10

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Calochortus leichtlinii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 907 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF4 907 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT · NCBI≈2.5 Gbp

01Narrative

Calochortus leichtlinii is a species of flowering plant in the lily family known by the common names Leichtlin's mariposa, smokey mariposa, and mariposa lily.sierrawildflowers.org, Sierra Wildflowers, "Common Name: Mariposa Lily"Hooker, Joseph Dalton 1870. Curtis's Botanical Magazine 96: plate 5862 plus 2 subsequent text pages description in Latin, commentary in English, full-page color illustration The plant is native to the Sierra Nevada and Modoc Plateau of California and adjacent parts of the Great Basin in southeastern Oregon and western Nevada.Biota of North America Program 2014 county distribution map It grows in coniferous forest and chaparral habitats, including the lowest grassy hills—such as along the Sierra Nevada boundary with the Central Valley and agriculture.Calflora taxon report, University of California @ Berkeley: Calochortus leichtlinii (Leichtlin's Mariposa Lily, smokey mariposa)Flora of North America, Calochortus leichtlinii The small underground bulbs were eaten by the Native Americans.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calochortus leichtlinii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences8

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF964152.1 ↗634 bpUSA

ACGT

AAACCCCGCCCGGACTCCCCCCGCGGACGGACGCCCTCGGGCGTCCGTCGGAGGGGACCGGGCGGGCCGACGGACGAAACCCCGGCGCGG …

Calochortus leichtlinii isolate CBP341 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Calochortus leichtlinii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈2 534 706 462 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Calochortus leichtlinii2.53 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 143×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Beal 1939

CCDB · book-fedorov — Beal, Ownbey 1943

CCDB · book-atlas-flowering-plants

n 71×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — CAVE, M.S. 1970. Chromosomes of California Liliaceae. Univ. Calif. Publ. Bot. 57: 1-58.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.996 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type4 907 records

Wild obs. + sensor4 563

Museum / vouchered343

Fossil1

Origin

Native2

Range

Area of Occupancy AOO7 232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 2 776≤1 km 412≤10 km 303>10 km 154

3 645 georeferenced · 918 without coordinates

Open the mapobservation + sensor4 563

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 12≤1 km 104≤10 km 72>10 km 3

191 georeferenced · 152 without coordinates

Open the institutions mapphysical evidence343

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	47
Davis, US	25
Claremont, US	24
Pullman, US	22
Fredericton Stock Culture Collectionlocation not on record	19
Ashland, US	16
Riverside, US	16
CASlocation not on record	14
Santa Barbara, US	12
Arcata, US	12
Angwin, US	11
Canadian Department of Agriculturelocation not on record	10
Truckee, US	8
San Diego, US	6
Northridge, US	4
San Luis Obispo, US	4
Bronx, US	3
Long Beach, US	3
Flagstaff, US	2
Corvallis, US	2
Henderson, US	2
Turlock, US	2
Santa Cruz, US	2
Macomb, US	1
Tempe, US	1
US	1
INFlocation not on record	1
Vancouver, CA	1
Madison, US	1

29 institutions · 272 of 343 vouchered records shown · 71 without an institution code

09Environmental DNA2 detections

Where the DNA of Calochortus leichtlinii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Calochortus leichtlinii

At a glance

Sources11 archives

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type4 907 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions24 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type4 907 records