Calochortus eurycarpus

S.Watson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Calochortus

At a glance

Occurrence records1 993

Data sources10

Biological traits14

DNA specimens4

eDNA detections2

Sources10 archives

Databases and archives Calochortus eurycarpus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 993 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF1 993 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Calochortus eurycarpus (white mariposa lily) is a North American species of flowering plant in the lily family. It is native to the western United States: Montana, Idaho, eastern Oregon, western Wyoming, northeastern Nevada (Box Elder County) and southeastern Washington (Asotin County + Garfield County).Biota of North America Program 2014 county distribution map Calochortus eurycarpus is a bulb-forming perennial with straight stems up to 50 cm tall. Flowers are white or pale lavender (or rarely pink) with a conspicuous reddish-purple blotch on the inside of each petal.Flora of North America Vol. 26 Page 129 Calochortus eurycarpus S. Watson

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass2.44 mg

Seed mass max2.44 mg

Seed mass min2.44 mg

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calochortus eurycarpus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPV814932.1 ↗543 bpUSA · 2020

ACGT

AAGTGCTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGC …

Calochortus eurycarpus voucher YNP_HA1149 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★trnL-F

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Calochortus eurycarpus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.072 ↗

08Occurrence & distribution

Record type1 993 records

Wild obs. + sensor1 308

Museum / vouchered685

Origin

Native1

Range

Area of Occupancy AOO4 600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 741≤1 km 77≤10 km 75>10 km 110

1 003 georeferenced · 305 without coordinates

Open the mapobservation + sensor1 308

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 78≤1 km 141≤10 km 136>10 km 12

367 georeferenced · 318 without coordinates

Open the institutions mapphysical evidence685

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions32 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow, US	108
Pullman, US	106
Boise, US	90
WTUlocation not on record	79
Corvallis, US	60
Pocatello, US	40
Bronx, US	38
Caldwell, US	27
Missoula, US	26
Provo, US	20
Ashland, US	18
Bozeman, US	15
Logan, US	8
Chongqing Museumlocation not on record	5
DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record	3
CASlocation not on record	3
University of Stellenboschlocation not on record	3
Henderson, US	2
Cheney, US	2
Yellowstone National Park Herbariumlocation not on record	2
SEFlocation not on record	2
Minia, EG	2
Bangkok, TH	2
Portland, US	2
Riverside, US	2
Bloomington, US	2
Tampa, US	1
Madison, US	1
Cambridge, US	1
Claremont, US	1
Chapel Hill, US	1
Columbia, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Wuzhou, CN	1
Bend, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
Johnson City, US	1
Vancouver, CA	1
Pittsburg, US	1
Flagstaff, US	1
Tacoma, US	1
University of Alberta Museumslocation not on record	1

42 institutions · 683 of 685 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Calochortus eurycarpus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

MeadowNear outlet, right off shore of lake, pretty…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 12.9–13.8

Seasonal swing summer↔winter23.2 °C

Max temp (day)20.3 °C 20.0–20.6

Min temp (night)7.10 °C 6.20–7.90

Precipitation55.9 mm/mo 50.0–61.7

Air humidity48.2 % 47.4–49.1

Moisture balance-81.8 mm/mo -84.0–-79.6

Vapour deficit797 Pa 786–808

Wind speed3.30 m/s 3.00–3.60

Cloud cover24.6 % 24.6–24.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Calochortus eurycarpus

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 993 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions32 of 42 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 993 records