Calochortus clavatus

S.Watson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Calochortus

At a glance

Occurrence records1 707

Data sources9

Biological traits14

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Calochortus clavatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 707 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF1 707 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Botanical illustration. Calochortus clavatus is a species of mariposa lily known by the common name clubhair mariposa lily. It is endemic to California where it is found in forests and on chaparral slopes.Calflora database: Calochortus clavatus . accessed 2.8.2013

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.43 mg

Seed mass max1.43 mg

Seed mass min1.43 mg

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calochortus clavatus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLKM085547.1 ↗1 226 bp

ACGT

TATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCGGAAGAGGCAGGG …

Calochortus clavatus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Calochortus clavatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · eflora

CCDB · eflora

n 81×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — CAVE, M.S. 1970. Chromosomes of California Liliaceae. Univ. Calif. Publ. Bot. 57: 1-58.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.997 ↗

08Occurrence & distribution

Record type1 707 records

Wild obs. + sensor1 499

Museum / vouchered208

Origin

Native18

Range

Area of Occupancy AOO2 676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 805≤1 km 94≤10 km 63>10 km 222

1 184 georeferenced · 315 without coordinates

Open the mapobservation + sensor1 499

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 8≤1 km 62≤10 km 32>10 km 1

103 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence208

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Riverside, US	42
Claremont, US	27
San Luis Obispo, US	25
Santa Barbara, US	22
Pullman, US	11
Northridge, US	9
Fredericton Stock Culture Collectionlocation not on record	5
Irvine, US	4
US	4
CASlocation not on record	4
Davis, US	4
San Diego, US	4
Long Beach, US	2
EL PASO, US	2
La Paz, MX	2
ASUlocation not on record	2
Arcata, US	2
Los Angeles, US	2
Ashland, US	1
Canadian Department of Agriculturelocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Chongqing Museumlocation not on record	1
Corvallis, US	1
Turlock, US	1
Tampa, US	1
Wuzhou, CN	1
Madison, US	1

27 institutions · 182 of 208 vouchered records shown · 26 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Calochortus clavatus

At a glance

Sources9 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 707 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions21 of 27 geolocated

Record type1 707 records