Calochortus catalinae

S.Watson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Calochortus

At a glance

Occurrence records3 307

Data sources12

Biological traits14

DNA specimens3

eDNA detections1

Sources12 archives

Databases and archives Calochortus catalinae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 307 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF3 307 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT · NCBI≈1.7 Gbp

01Narrative

Calochortus catalinae is a species of mariposa lily known by the common name Santa Catalina mariposa lily.Jepson eFlora (TJM2): Calochortus catalinae . accessed 4.16.2015

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.51 mg

Seed mass max1.56 mg

Seed mass min1.46 mg

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calochortus catalinae has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM085546.1 ↗1 226 bp

ACGT

TATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCGGAAGAGGCAGGG …

Calochortus catalinae ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Calochortus catalinae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 723 440 397 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Calochortus catalinae1.72 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 145×CCDB · eflora · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · eflora

CCDB · book-fedorov — Newton 1927

CCDB · book-fedorov — Beal 1939

CCDB · book-fedorov — Beal, Ownbey 1943

CCDB · book-atlas-flowering-plants

n 71×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — CAVE, M.S. 1970. Chromosomes of California Liliaceae. Univ. Calif. Publ. Bot. 57: 1-58.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.999 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type3 307 records

Wild obs. + sensor2 799

Museum / vouchered508

Origin

Native112

Range

Area of Occupancy AOO2 796 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 1 692≤1 km 217≤10 km 111>10 km 137

2 157 georeferenced · 642 without coordinates

Open the mapobservation + sensor2 799

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 27≤1 km 187≤10 km 108>10 km 14

336 georeferenced · 172 without coordinates

Open the institutions mapphysical evidence508

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	122
Santa Barbara, US	87
US	50
Riverside, US	49
Los Angeles, US	30
Irvine, US	22
Long Beach, US	20
San Diego, US	20
Pullman, US	13
CASlocation not on record	12
Northridge, US	7
San Luis Obispo, US	7
Davis, US	6
Catalina Island Conservancylocation not on record	6
San Bernardino, US	4
Canadian Department of Agriculturelocation not on record	3
Provo, US	3
Arcata, US	3
Fredericton Stock Culture Collectionlocation not on record	2
Ashland, US	2
Bloomington, US	2
Dekalb, US	1
San Diego Natural History Museumlocation not on record	1
Bronx, US	1
Chapel Hill, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Tampa, US	1
Albuquerque, US	1
Cambridge, US	1
Bangkok, TH	1
Angwin, US	1

31 institutions · 480 of 508 vouchered records shown · 28 without an institution code

09Environmental DNA1 detections

Where the DNA of Calochortus catalinae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

Grassland with Bloomeria crocea, Foeniculum …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 15.0–15.0

Seasonal swing summer↔winter10.9 °C

Max temp (day)20.2 °C

Min temp (night)10.5 °C

Precipitation19.9 mm/mo

Air humidity60.9 %

Moisture balance-100 mm/mo

Vapour deficit667 Pa

Wind speed2.30 m/s

Cloud cover31.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Calochortus catalinae

At a glance

Sources12 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type3 307 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions25 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 307 records