Calochortus aureus

S.Watson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Calochortus

At a glance

Occurrence records330

Data sources8

Biological traits14

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Calochortus aureus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility330 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF330 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 32

01Narrative

Calochortus aureus is a North American species of flowering plants in the lily family.Tropicos, Calochortus aureus S.Wats.Watson, Sereno 1873. American Naturalist 7(5): 303 It is native to the southwestern United States (Arizona, southern Utah, northwestern New Mexico and southwestern Colorado).Kew World Checklist of Selected Plant FamiliesBiota of North America Program 2014 county distribution map n Calochortus aureus is a bulb-forming perennial herb producing a single stalk up to 30 cm tall. Flowers are bright lemon-yellow with red or purple splotches on the petals.Flora of North America Vol. 26 Page 137 Calochortus aureus Baker

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass4.06 mg

Seed mass max4.06 mg

Seed mass min4.06 mg

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calochortus aureus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLKM085544.1 ↗1 226 bp

ACGT

TATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCGGAAGAGGCAGGG …

Calochortus aureus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Calochortus aureus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records32–322n range32median32mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 322×CCDB · eflora · CCDB · book-atlas-flowering-plants

CCDB · eflora

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type330 records

Wild obs. + sensor222

Museum / vouchered108

Range

Area of Occupancy AOO852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 102≤1 km 18≤10 km 12>10 km 60

192 georeferenced · 30 without coordinates

Open the mapobservation + sensor222

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤1 km 9≤10 km 15>10 km 4

28 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence108

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	22
Flagstaff, US	17
ASUlocation not on record	12
Provo, US	11
Albuquerque, US	11
Phoenix, US	9
Pullman, US	6
Ashland, US	3
Orem, US	3
Henderson, US	2
Denver, US	2
DOI/NPS, Colonial National Historical Parklocation not on record	2
Moscow, US	2
Riverside, US	1
Weber State Universitylocation not on record	1
Logan, US	1
Millersville, US	1
Madison, US	1
DOI/NPS, Greenbelt Parklocation not on record	1

19 institutions · 108 of 108 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)