Calochortus apiculatus

Baker · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Calochortus

At a glance

Occurrence records1 921

Data sources10

Biological traits11

DNA specimens6

eDNA detections4

Sources10 archives

Databases and archives Calochortus apiculatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 921 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF1 921 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Calochortus apiculatus is a North American species of flowering plants in the lily family.Baker, John Gilbert 1874. Journal of the Linnean Society, Botany 14(76): 305 in LatinTropicos, Calochortus apiculatus Baker

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass2.09 mg

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calochortus apiculatus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences6

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMG225641.1 ↗552 bpCanada · 2002

ACGT

AGTGCTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Calochortus apiculatus voucher CCDB-18343-E7 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Calochortus apiculatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 203×CCDB · eflora · CCDB · book-fedorov

CCDB · eflora

CCDB · book-fedorov — Beal 1939

CCDB · book-fedorov — Beal, Ownbey 1943

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.072 ↗

08Occurrence & distribution

Record type1 921 records

Wild obs. + sensor1 532

Museum / vouchered389

Origin

Native1

Range

Area of Occupancy AOO4 796 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy45% within 1 km

≤100 m 530≤1 km 102≤10 km 59>10 km 705

1 396 georeferenced · 136 without coordinates

Open the mapobservation + sensor1 532

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 20≤1 km 60≤10 km 74>10 km 11

165 georeferenced · 224 without coordinates

Open the institutions mapphysical evidence389

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Missoula, US	90
Moscow, US	60
Pullman, US	49
Vancouver, CA	32
University of Lethbridgelocation not on record	28
WTUlocation not on record	23
Bozeman, US	18
University of Alberta Museumslocation not on record	15
Cheney, US	12
Bronx, US	11
Boise, US	11
Victoria, CA	8
Corvallis, US	4
Pocatello, US	4
Madison, US	3
Spearfish, US	3
Bangkok, TH	2
Whitehorse, CA	2
Research Collection of B. A. Bennettlocation not on record	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Auckland, NZ	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Caldwell, US	1
Chicago, US	1
Wuzhou, CN	1
Provo, US	1
Denver, US	1
Logan, US	1
Riverside, US	1

29 institutions · 387 of 389 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Calochortus apiculatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.90 °C 1.20–12.6

Seasonal swing summer↔winter24.6 °C

Max temp (day)12.4 °C 6.60–18.2

Min temp (night)1.10 °C -3.90–6.20

Precipitation104 mm/mo 99.4–108

Air humidity56.9 % 54.1–59.7

Moisture balance10.0 mm/mo -7.60–27.6

Vapour deficit529 Pa 352–706

Wind speed4.60 m/s 1.90–7.40

Cloud cover39.5 % 38.3–40.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Calochortus apiculatus

At a glance

Sources10 archives

Size & morphology1

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 921 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions23 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 921 records