Calochlaena dubia

(R.Br.) M.D.Turner & R.A.White · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Cyatheales/Dicksoniaceae/Calochlaena

At a glance

Occurrence records16 032

Data sources10

Biological traits27

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Calochlaena dubia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 032 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF16 032 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT2.5 Gbp

01Narrative

Calochlaena dubia, commonly known as soft bracken, false bracken, common ground fern or rainbow fern, is a small Australian fern in the treefern family Dicksoniaceae. It is very common within its range, and often seen growing under eucalyptus forest, often on the poorer quality soils. It is an easy plant to grow in the garden.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Leaf length550 mm

Leaf mass7 mg

Leaf mass per area35.97 g/m2

Leaf size164 mm²

Leaf width2.7 mm

Plant height1.75 m

⚠ sources differ — AusTraits: 1.75 m · TRY: 0.8 m

Plant height max1.5 m

Plant height min0.4 m

Seed mass0.001 mg

Life cycle & reproduction6

Dispersal typewind

Life spanperennial

Lifespan years100 years

Pollination syndromeabiotic

Reproductive maturity8 years

Resprouting capacityresprouts

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formfern

Leaf compoundnesscompound

Leaf shapetriangular

Woodinessnon-woody

⚠ sources differ — TRY: non-woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)27.8 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calochlaena dubia has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLU05615.1 ↗1 288 bp

ACGT

GCTGGTGTTAAAGATTATCGATTGACCTATTACACTCCCGATTATGTAACCAAAGACACCGATATATTGGCGGCCTTTCGAATGACCCCG …

Culcita dubia chloroplast large subunit ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcL) gene, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Calochlaena dubia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 464 560 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Calochlaena dubia2.46 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 112 n = 56

Ploidy2× diploid · measured

Chromosome records112–1162n range112median112mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1122×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Tindale. 2002. In M. D. Tindale & S. K. Roy, A cytotaxonomic survey of the Pteridophyta of Australia. Austral. Syst. Bot. 15: 839–937.

2n 1161×CCDB · book-LoveLove1977

CCDB · book-LoveLove1977 — Manton (in Holttum 1963)

n 562×CCDB · barker-ferns · CCDB · ipcn-api-dl

CCDB · barker-ferns — Tindale, Mary D., and S. K. Roy. "A cytotaxonomic survey of the Pteridophyta of Australia."Australian Systematic Botany15.6 (2002): 839-937.

CCDB · ipcn-api-dl — Tindale. 2002. In M. D. Tindale & S. K. Roy, A cytotaxonomic survey of the Pteridophyta of Australia. Austral. Syst. Bot. 15: 839–937.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type16 032 records

Wild obs. + sensor14 772

Museum / vouchered895

Cultivated / captive2

Other363

Origin

Native172

Introduced1

Range

Area of Occupancy AOO27 960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 12 140≤1 km 1 773≤10 km 369>10 km 72

14 354 georeferenced · 418 without coordinates

Open the mapobservation + sensor14 772

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 101≤1 km 131≤10 km 453>10 km 109

794 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence895

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	208
Mount Annan, AU	172
Canberra, AU	150
Brisbane, AU	104
Hobart, AU	81
Adelaide, AU	34
Armidale, AU	30
NSW Dept of Planning, Industry and Environmentlocation not on record	23
John T. Waterhouse Herbariumlocation not on record	21
Smithfield, AU	14
Wellington, NZ	10
Wollongong, AU	9
Auckland, NZ	9
Kew, GB	7
James Cook Townsvillelocation not on record	5
QVMAGlocation not on record	5
Parkville, AU	4
Batemans Bay, AU	3
University of Stellenboschlocation not on record	2
Museo Nacional de Costa Rica (MNCR)location not on record	1
Moscow State Universitylocation not on record	1
Saint Louis, US	1
La Trobe Universitylocation not on record	1

23 institutions · 895 of 895 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Calochlaena dubia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Calochlaena dubia

At a glance

Sources10 archives

Size & morphology9

Life cycle & reproduction6

Diet & foraging1

Habitat & environment8

Physiology & chemistry3

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type16 032 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 23 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type16 032 records