Calochilus herbaceus

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Calochilus

At a glance

Occurrence records553

Data sources5

Biological traits28

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Calochilus herbaceus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility553 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF553 records

DNA & barcodingNCBIsequences

01Narrative

Calochilus herbaceus, commonly known as the pale beard orchid, is a species of orchid native to south-eastern Australia and northern New Zealand. It has a single very short, rigid, fleshy leaf and up to eight pale green to brownish flowers with reddish stripes and a purple "beard".

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology7

Leaf length60 mm

Leaf size1 885 mm²

Leaf width9 mm

Plant height0.4 m

Plant height max0.4 m

Plant height min0.15 m

Seed mass0.003 mg

Life cycle & reproduction8

Dispersal typewind

Flowering timennnnnnnnyyyy

Life formtuberous geophyte

Life spanperennial

Pollination syndromeinsect

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelanceolate linear

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calochilus herbaceus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences8

The DNA barcodea real sequence read deposited for this species

ITSKJ081793.1 ↗702 bp

ACGT

ATCATTGTCGAGACCCGCAAGAGACCGAGCAATTTTGACAACCGGTGAACTAAATGTACGGTGGAAGCGAAAGCTCGCCGCCGCCACCAC …

Calochilus herbaceus isolate D295 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type553 records

Wild obs. + sensor339

Museum / vouchered213

Cultivated / captive1

Origin

Native9

Range

Area of Occupancy AOO1 376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 141≤1 km 55≤10 km 48>10 km 51

295 georeferenced · 44 without coordinates

Open the mapobservation + sensor339

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 22≤1 km 104≤10 km 60>10 km 9

195 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence213

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	99
Hobart, AU	66
Museo Entomologico de Leonlocation not on record	27
Mount Annan, AU	8
Adelaide, AU	7
Christchurch, NZ	4
QVMAGlocation not on record	2

7 institutions · 213 of 213 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)