Callopsis volkensii

Engl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Callopsis

At a glance

Occurrence records87

Data sources11

Biological traits11

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Callopsis volkensii's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility87 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF87 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Callopsis is a monotypic genus from the plant family Araceae and has only one species, Callopsis volkensii. This plant forms a creeping rhizome and has cordate-ovate leaves that are medium green and glaborous. The inflorescence is typical of the family Araceae, with a white spathe and yellow spadix. The spadix is shorter than the spathe and its male and female flowers are separated shortly.Simon J. Mayo, Josef Bogner, Peter C. Boyce: The Genera of Araceae. Royal Botanic Gardens/Kew Publishing, London 1997, (full-text as PDF-file; Continental Printing, Belgium 1997).Flora of Tropical Africa, 'Aroideae', Brown, N.E., 1901, 8 (1):137–192 It grows at an altitude of 800 m in virgin forest in parts of eastern Africa (Kenya and Tanzania). There have been reports of the species in Cameroon, but these remain unconfirmed.Kew World Checklist of Selected Plant FamiliesGovaerts, R. & Frodin, D.G. (2002). World Checklist and Bibliography of Araceae (and Acoraceae): 1-560. The Board of Trustees of the Royal Botanic Gardens, Kew.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height0.15 m

Life cycle & reproduction2

Life formrhizomatous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callopsis volkensii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLAM905773.1 ↗1 391 bp

ACGT

TCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAA …

Callopsis volkensii plastid partial rbcL gene for ribulose-biphosphate carboxylase

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Callopsis volkensii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records36–362n range36median36mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 362×CCDB · book-ipcn67-71 · CCDB · araceae

CCDB · book-ipcn67-71 — MARCHANT, C.J. 1971. Chromosome variations in Araceae II. Richardieae to Colocasieae. Kew Bull. 25: 27-56.

CCDB · araceae — Marchant, 1971a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

07Deep time~63.7 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin63.7 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The dashed rules marked ✦ are the five great mass extinctions. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock originmass extinction

08Occurrence & distribution

Record type87 records

Wild obs. + sensor24

Museum / vouchered63

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 6

6 georeferenced · 18 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 63 records without

Open the institutions mapphysical evidence63

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Arusha, TZ	21
Saint Louis, US	10
DSMlocation not on record	6
Kew, GB	4
Fort Worth, US	3
TAFORI-LSRClocation not on record	2
EAlocation not on record	2
MeiseBGlocation not on record	2
Miami, US	2
Clocation not on record	1
MAlocation not on record	1
University of Stellenboschlocation not on record	1

12 institutions · 55 of 63 vouchered records shown · 8 without an institution code

09Environmental DNA2 detections

Where the DNA of Callopsis volkensii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)