Callophyllis variegata

(Bory de Saint-Vincent) Kützing · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Gigartinales/Kallymeniaceae/Callophyllis

At a glance

Occurrence records600

Data sources6

Biological traits4

DNA specimens64

eDNA detections45

Sources6 archives

Databases and archives Callophyllis variegata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility547 records↗

OBISOcean Biodiversity Information System53 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics64 specimens↗

NCBIUS National Library of Medicinesequences↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS600 records

Environmental DNA2 datasets · 4 countries45 detections

DNA & barcodingBOLD · NCBI64 specimens

01Narrative

Callophyllis variegata, commonly known as carola, is a type of edible seaweed, a member of the genus Callophyllis. Callophyllis variegata occurs in Concepción de Chile and other parts of South America such as Peru, the Falkland Islands, Tierra del Fuego. But also in New Guinea, South Africa, Australia, New Zealand, Alaska, St. Paul Island (Indian Ocean), Antarctic and subantarctic islands such as the Graham Land, Kerguelen, Macquarie Island, South Georgia, and the South Orkney Islands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length40 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Uses & economy1

Commercial importanceof potential interest

05DNA & barcoding64 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callophyllis variegata has left across the world's sequence archives.

At a glance

DNA specimens64

BINs1

Marker genes6

GenBank sequences10

eDNA detections45

The DNA barcodea real sequence read deposited for this species

ITSMG700509.1 ↗615 bpChile · 2015

ACGT

TCATTTTTCCTTTTTCGTGCACTTTCTTAACTATTTTTTTTATTGTCAACCAAACCTATTCAAAACCAAAAATAAACAATTTATTTTACA …

Callophyllis variegata voucher Coch022 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Callophyllis violaceasame genus3.9%Callophyllis schneiderisame genus3.9%Callophyllis flabellulatasame genus4.2%Callophyllis thompsoniisame genus4.2%Callophyllis beringensissame genus4.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL★ITS1028S28S-D2UPA

animal barcodeplant barcodefungal barcodemarker

08Occurrence & distribution

Record type600 records

Wild obs. + sensor138

Museum / vouchered436

Other26

Origin

Native15

Range

Area of Occupancy AOO808 km²

Depth

0–200 m sunlit13

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5 m · max 5 m · 13 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤100 m 6≤1 km 1≤10 km 84>10 km 2

93 georeferenced · 45 without coordinates

Open the mapobservation + sensor138

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 13≤1 km 16≤10 km 113>10 km 29

171 georeferenced · 265 without coordinates

Open the institutions mapphysical evidence436

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wellington, NZ	92
Bronx, US	78
Chapel Hill, US	39
Auckland, NZ	38
New Haven, US	29
Museo Entomologico de Leonlocation not on record	18
Ann Arbor, US	17
US	15
San Diego, US	4
Minia, EG	4
LDlocation not on record	4
Durham, US	3
Davenport, US	3
Burlington, US	3
Champaign, US	3
PHlocation not on record	3
Stanford Universitylocation not on record	3
FLASlocation not on record	2
University of New Brunswick, Frederictonlocation not on record	2
Butler Universitylocation not on record	2
UMAGlocation not on record	2
Cincinnati, US	2
MeiseBGlocation not on record	1
Madrid, ES	1
Brown Universitylocation not on record	1

25 institutions · 369 of 436 vouchered records shown · 52 without an institution code

09Environmental DNA45 detections

Where the DNA of Callophyllis variegata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys2

Countries4

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.5 °C 6.80–12.7

Seasonal swing summer↔winter6.00 °C

Max temp (day)13.1 °C 9.80–14.6

Min temp (night)9.90 °C 4.10–10.8

Precipitation91.1 mm/mo 11.5–139

Air humidity65.9 % 60.8–67.7

Moisture balance52.2 mm/mo

Vapour deficit464 Pa 369–542

Wind speed4.70 m/s

Cloud cover40.1 % 32.9–51.4

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)