Callitris verrucosa

(A.Cunn. ex Endl.) F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Cupressaceae/Callitris

At a glance

Occurrence records4 599

Data sources12

Biological traits36

DNA specimens3

eDNA detections4

Sources12 archives

Databases and archives Callitris verrucosa's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 599 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF4 599 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT10.2 Gbp

01Narrative

Callitris verrucosa is a species of conifer in the family Cupressaceae. It is found only in Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length20 mm

Fruit width22.5 mm

Leaf length2 mm

Leaf length max4 mm

Leaf length min2 mm

Leaf mass per area140 g/m2

Leaf size200 mm²

Leaf width1 mm

Plant height5.5 m

Plant height max8 m

Seed length5.81 mm

Seed mass11.72 mg

⚠ sources differ — TRY: 11.72 mg · AusTraits: 11.72 mg · GIFT: 15.58 mg

Seed mass max35.98 mg

Seed mass min9.68 mg

Seed width4 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typewind

Life formtree

Life spanperennial

Pollination syndromeabiotic

Raunkiær life formphanerophyte

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typestrobilus

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density682 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callitris verrucosa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLLC405349.1 ↗1 254 bp

ACGT

TTATTATACTCCCGAATATCCGACCAAAGATACTGATATCTTAGCAGCCTTCCGCGTCACTCCCCAACCTGGAGTGCCCCCCGAAGAAGC …

Callitris verrucosa Konardin Track 1 chloroplast rbcL gene for ribulose bisphosphate carboxylase large chain, partial sequence, sequence_id: Konardin Track 1_122

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL4★ITS

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Callitris verrucosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size10 171 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Callitris verrucosa10.17 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · Cave1956

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Li, L. c., B. Cong, C. Liu, Y. q. Liu & R. f. Weng. 1994. Karyotype analysis of 3 species of Callitris (Cupressaceae) in Australia and its phylogenetic significance. Acta Bot. Yunnan. 16(4): 349–353.

CCDB · Cave1956 — Mehra & Khoshoo a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 599 records

Wild obs. + sensor3 856

Museum / vouchered705

Cultivated / captive26

Fossil7

Other5

Origin

Native2 053

Introduced1

Range

Area of Occupancy AOO9 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 2 193≤1 km 932≤10 km 555>10 km 58

3 738 georeferenced · 118 without coordinates

Open the mapobservation + sensor3 856

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 144≤1 km 181≤10 km 230>10 km 89

644 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence705

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy57% within 1 km

≤100 m 7≤1 km 5≤10 km 9

21 georeferenced · 5 without coordinates

Open the mapnot free-living26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	287
Canberra, AU	92
Museo Entomologico de Leonlocation not on record	89
Mount Annan, AU	82
Kensington, AU	22
Bronx, US	12
John T. Waterhouse Herbariumlocation not on record	12
Brisbane, AU	8
Armidale, AU	6
Edinburgh, GB	5
BGPAlocation not on record	5
EL PASO, US	4
Hobart, AU	3
Parkville, AU	3
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Smithfield, AU	3
Beijing, CN	2
Berlin, DE	1
Pullman, US	1
Saint Louis, US	1
Palmerston, AU	1
La Trobe Universitylocation not on record	1
NAlocation not on record	1

23 institutions · 644 of 705 vouchered records shown · 59 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Callitris verrucosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Callitris verrucosa

At a glance

Sources12 archives

Size & morphology15

Life cycle & reproduction8

Diet & foraging1

Habitat & environment8

Physiology & chemistry3

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type4 599 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 23 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 599 records