Callitris rhomboidea

R.Br. ex Rich. & A.Rich. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Cupressaceae/Callitris

At a glance

Occurrence records4 234

Data sources15

Biological traits44

DNA specimens10

eDNA detections9

Sources15 archives

Databases and archives Callitris rhomboidea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 222 records↗

OBISOcean Biodiversity Information System12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources44 traits

Chemical compositionLOTUS · NPASS31 compounds

Occurrence & distributionGBIF · OBIS4 234 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB · GoaT9.9 Gbp

01Narrative

Callitris rhomboidea est une espèce de conifères de la famille des Cupressaceae originaire d'Australie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology16

Fruit length14 mm

⚠ sources differ — AusTraits: 14 mm · GIFT: 9 mm

Fruit width20 mm

Leaf length2.5 mm

Leaf length max3 mm

Leaf length min2 mm

Leaf mass128 mg

Leaf mass per area204 g/m2

Leaf size635 mm²

Leaf width1 mm

Plant height10 m

⚠ sources differ — GIFT: 10 m · AusTraits: 11 m · TRY: 10 m

Plant height max15 m

Seed length4.5 mm

Seed mass4.93 mg

⚠ sources differ — TRY: 4.93 mg · AusTraits: 4.87 mg · GIFT: 5.91 mg

Seed mass max10.1 mg

Seed mass min3.24 mg

Seed width2 mm

Life cycle & reproduction12

Deciduousnessevergreen

Dispersal typewind

Life formshrub or tree

Life span>50

⚠ sources differ — TRY: >50 · AusTraits: perennial · GIFT: perennial

Lifespan years50 years

Pollination modeabiotic

Pollination syndromeabiotic

⚠ sources differ — AusTraits: abiotic · GIFT: wind

Raunkiær life formphanerophyte

Reproduction asexualabsent

Reproductive maturity5.5 years

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typestrobilus

Growth formtree

Habitat GIFTLowland

Leaf compoundnesssimple

Mycorrhiza typePh.th.end.

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)4.95 mm²/mg

Wood density498 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition31 compounds

Compounds documented for Callitris rhomboidea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Aspidosperma type18

Jatrophane diterpenoids6

Corynanthe type5

Labdane diterpenoids1

Documented compounds31 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,9R,16R,17S,21R)-2,12-diazahexacyclo[14.2.2.19,12.01,9.03,8.016,21]henicosa-3,5,7,14-tetraen-17-ol	present	NPASS
(1S,4R,12S,13R,20R)-5,16-diazahexacyclo[11.6.1.11,4.04,12.06,11.016,20]henicosa-6,8,10-trien-2-one	present	NPASS
16-Epikopsinine	present	NPASS
16-Epipleiocarpamine	present	NPASS
2H-2,7a-Methanoindolo[2,3-a]quinolizine-13-carboxylic acid, 13-[(acetyloxy)methyl]-3-ethylidene-1,3,4,6,7,12b-hexahydro-, methyl ester, (2S,3E,5S,7aS,12bS,13R)-	present	NPASS
4-Epiisocommunic acid	present	LOTUS
[(1R,2R,3aR,5S,6E,10R,11S,13R,13aS)-1,3a,10,11,13-pentaacetyloxy-2,5,8,8-tetramethyl-12-methylidene-4,9-dioxo-3,5,10,11,13,13a-hexahydro-1H-cyclopenta[12]annulen-2-yl] benzoate	present	NPASS
[(1R,2R,3aR,5S,6E,9S,10S,11S,13R,13aS)-1,2,3a,9,10,13-hexaacetyloxy-2,5,8,8-tetramethyl-12-methylidene-4-oxo-1,3,5,9,10,11,13,13a-octahydrocyclopenta[12]annulen-11-yl] benzoate	present	NPASS
[(1R,2R,3aR,5S,6E,9S,10S,11S,13R,13aS)-1,3a,9,10,11,13-hexaacetyloxy-2,5,8,8-tetramethyl-12-methylidene-4-oxo-1,3,5,9,10,11,13,13a-octahydrocyclopenta[12]annulen-2-yl] benzoate	present	NPASS
[(1S,2S,3aR,5S,6E,10R,11S,13R,13aR)-1,3a,10,13-tetraacetyloxy-2,5,8,8-tetramethyl-12-methylidene-4,9-dioxo-1,2,3,5,10,11,13,13a-octahydrocyclopenta[12]annulen-11-yl] benzoate	present	NPASS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callitris rhomboidea has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes5

GenBank sequences10

eDNA detections9

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH280060.1 ↗1 180 bp

ACGT

CGGCGACGTCGCGAGAAGTTCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTACCGTAGGTGAACCTGCGGTAGGAT …

Callitris rhomboidea haplotype 34 and 33 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS9trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT

The complete instruction manual Callitris rhomboidea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size9 853 350 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Callitris rhomboidea9.85 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×GoaT · Kew Plant DNA C-values Database · CCDB · Cave1956

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · Cave1956 — Mehra & Khoshoo a

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Gulline, H. F. 2003. <In> R. J. E. Wiltshire & W. D. Jackson, Index of chromosome numbers of Tasmanian spermatophytes. Pap. & Proc. Roy. Soc. Tasmania 137: 39–53.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 234 records

Wild obs. + sensor3 107

Museum / vouchered1 074

Cultivated / captive42

Other11

Origin

Native390

Introduced40

Range

Area of Occupancy AOO7 496 km²

Depth

0–200 m sunlit10

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 25.8 m · max 1 000 m · 12 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 1 775≤1 km 658≤10 km 275>10 km 35

2 743 georeferenced · 364 without coordinates

Open the mapobservation + sensor3 107

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 83≤1 km 333≤10 km 357>10 km 70

843 georeferenced · 231 without coordinates

Open the institutions mapphysical evidence1 074

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy85% within 1 km

≤100 m 7≤1 km 16≤10 km 4

27 georeferenced · 15 without coordinates

Open the mapnot free-living42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	198
Museo Entomologico de Leonlocation not on record	154
Adelaide, AU	145
Hobart, AU	124
Canberra, AU	117
Brisbane, AU	49
Kew, GB	45
Auckland, NZ	35
John T. Waterhouse Herbariumlocation not on record	29
Armidale, AU	22
Rotorua, NZ	19
Bronx, US	15
QVMAGlocation not on record	12
Edinburgh, GB	10
Batemans Bay, AU	6
Christchurch, NZ	5
Berlin, DE	5
Wollongong, AU	5
La Trobe Universitylocation not on record	4
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Taipei, TW	3
Durban, ZA	3
Santa Barbara, US	3
Honolulu, US	2
US	2
Parkville, AU	2
TAFORI-LSRClocation not on record	2
BISHlocation not on record	2
Moscow State Universitylocation not on record	2
Dekalb, US	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Saint Louis, US	1
South Kensington, GB	1
Santa Cruz, US	1
University of Alberta Museumslocation not on record	1
Wuzhou, CN	1
LNBG$location not on record	1
LDlocation not on record	1
Cape Town, ZA	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Kensington, AU	1
Santiago de Compostela, ES	1
GAlocation not on record	1

45 institutions · 1 042 of 1 074 vouchered records shown · 19 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Callitris rhomboidea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 16.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C 22.6–28.5

Min temp (night)15.0 °C 11.6–15.0

Precipitation15.6 mm/mo 15.6–63.9

Air humidity43.4 % 43.4–56.0

Moisture balance-143 mm/mo -143–-53.6

Vapour deficit1,624 Pa 914–1,624

Wind speed4.00 m/s 2.80–4.00

Cloud cover18.1 % 18.1–22.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Callitris rhomboidea

At a glance

Sources15 archives

Size & morphology16

Life cycle & reproduction12

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Other traits1

Compound class profile4 classes

Documented compounds31 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type4 234 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions29 of 45 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 234 records