Callitris oblonga

Rich. & A.Rich. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Cupressaceae/Callitris

At a glance

Occurrence records609

Data sources10

Biological traits30

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Callitris oblonga's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility609 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF609 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Callitris oblonga, also called South Esk pine, pigmy cypress pine,Eckenwalder, J.E. 2009. Conifers of the World: The Complete Reference. Timber Press river pine, or Tasmanian cypress pine, is a species of conifer in the family Cupressaceae. It is endemic to Australia, and is threatened by habitat loss. The last remaining significant stand of subspecies oblonga is protected in the South Esk Pine Reserve. Subspecies parva occurs in northern NSW on the eastern edge of the Northern Tablelands in Werrikimbe National Park.Threatened Species Retrieved on 13-3-2009

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Leaf length4 mm

Leaf length max5 mm

Leaf length min4 mm

Leaf width1 mm

Plant height5 m

Plant height max5 m

Seed mass4.5 mg

⚠ sources differ — TRY: 4.5 mg · AusTraits: 4.61 mg · GIFT: 4.29 mg

Seed mass max6.05 mg

Seed mass min2.3 mg

Seed width2 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typewind

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Reproductive maturity6 years

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typestrobilus

Growth formtree

Leaf compoundnesssimple

Mycorrhiza typePh.th.end.

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition4 compounds

Compounds documented for Callitris oblonga across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavones4

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
Amentoflavone	present	LOTUS
Bilobetin	present	LOTUS
Cupressuflavone	present	LOTUS
Hinokiflavone	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callitris oblonga has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences10

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSMH280026.1 ↗1 110 bp

ACGT

CGTAACAAGGTTACCGTAGGTGAACCTGCGGTAGGATCATTGTCGGACCCGGTCCCTATCAACTGTGCAGGAGAGGGCGCAAGTCGCACT …

Callitris oblonga subsp. parva haplotype parva 2 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL6★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type609 records

Wild obs. + sensor422

Museum / vouchered174

Cultivated / captive13

Origin

Native17

Introduced16

Range

Area of Occupancy AOO572 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 352≤1 km 31≤10 km 23>10 km 6

412 georeferenced · 10 without coordinates

Open the mapobservation + sensor422

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 5≤1 km 64≤10 km 30>10 km 2

101 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence174

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced · 10 without coordinates

Open the mapnot free-living13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	37
Museo Entomologico de Leonlocation not on record	25
Kew, GB	20
Mount Annan, AU	17
Bronx, US	10
Adelaide, AU	9
Canberra, AU	9
Christchurch, NZ	7
QVMAGlocation not on record	7
Berlin, DE	6
Edinburgh, GB	5
Brisbane, AU	4
John T. Waterhouse Herbariumlocation not on record	3
Auckland, NZ	3
Rotorua, NZ	3
Armidale, AU	2
Canadian Department of Agriculturelocation not on record	2
ISAlocation not on record	1
Davis, US	1
Durban, ZA	1
Parkville, AU	1
South Kensington, GB	1

22 institutions · 174 of 174 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Callitris oblonga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)