Callitris muelleri

(Parl.) Benth. & Hook.f. ex F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Cupressaceae/Callitris

At a glance

Occurrence records341

Data sources9

Biological traits28

DNA specimens3

eDNA detections2

Sources9 archives

Databases and archives Callitris muelleri's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility341 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF341 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Callitris muelleri is a species of conifer in the family Cupressaceae. It is found only in New South Wales, Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Fruit width25 mm

Leaf length6.5 mm

Leaf length max10 mm

Leaf length min5 mm

Plant height6 m

Seed length5.48 mm

Seed mass13.86 mg

⚠ sources differ — TRY: 13.86 mg · AusTraits: 13.0 mg · GIFT: 14.14 mg

Seed mass max14.98 mg

Seed mass min13.02 mg

Seed width4 mm

Life cycle & reproduction7

Deciduousnessevergreen

Life formtree

Life spanperennial

Lifespan years50 years

⚠ sources differ — TRY: 50 years · AusTraits: 37.5 years

Raunkiær life formphanerophyte

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typestrobilus

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callitris muelleri has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences9

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY178412.1 ↗847 bp

ACGT

ATGCGAACGCGGCTGGTACAAAAAGAGGTCCTGTACAGTCGCAGTTGCGGAGGAAACCGAGCCGTCCGCTCCGTATACGGGCGACGCCAT …

Callitris muelleri 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK5★rbcL3★ITS1

animal barcodeplant barcodefungal barcode

08Occurrence & distribution

Record type341 records

Wild obs. + sensor136

Museum / vouchered187

Cultivated / captive17

Other1

Origin

Native90

Range

Area of Occupancy AOO780 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 82≤1 km 25≤10 km 12>10 km 3

122 georeferenced · 14 without coordinates

Open the mapobservation + sensor136

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 8≤1 km 50≤10 km 94>10 km 10

162 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence187

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 8

12 georeferenced · 5 without coordinates

Open the mapnot free-living17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	90
Museo Entomologico de Leonlocation not on record	22
Canberra, AU	13
John T. Waterhouse Herbariumlocation not on record	12
Wollongong, AU	11
Kew, GB	10
Brisbane, AU	9
Adelaide, AU	7
Auckland, NZ	2
Armidale, AU	2
Berlin, DE	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
University of Stellenboschlocation not on record	1
Pullman, US	1
Christchurch, NZ	1
LDlocation not on record	1
Edinburgh, GB	1

17 institutions · 185 of 187 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Callitris muelleri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)