Callitris monticola

J.Garden · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Cupressaceae/Callitris

At a glance

Occurrence records240

Data sources7

Biological traits27

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Callitris monticola's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility240 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF240 records

DNA & barcodingNCBIsequences

01Narrative

Callitris monticola, or dwarf cypress, is a species of conifer in the family Cupressaceae. It shares the common name with several other plants. It is found only in Australia. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Fruit width22.5 mm

Leaf length2.5 mm

Leaf length max4 mm

Leaf length min2 mm

Plant height2.5 m

Plant height max2.5 m

Seed length4.21 mm

Seed mass4.43 mg

Seed mass max4.94 mg

Seed mass min4.06 mg

Seed width2.85 mm

Life cycle & reproduction6

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Reproductive maturity9 years

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typestrobilus

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callitris monticola has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences7

The DNA barcodea real sequence read deposited for this species

rbcLLC405314.1 ↗1 254 bp

ACGT

TTATTATACTCCCGAATATCCGACCAAAGATACTGATATCTTAGCAGCCTTCCGCGTCACTCCCCAACCTGGAGTGCCCCCCGAAGAAGC …

Callitris monticola CRISP10707 chloroplast rbcL gene for ribulose bisphosphate carboxylase large chain, partial sequence, sequence_id: CRISP10707_085

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL3

plant barcode

08Occurrence & distribution

Record type240 records

Wild obs. + sensor101

Museum / vouchered123

Cultivated / captive16

Origin

Native23

Range

Area of Occupancy AOO276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 86≤1 km 3≤10 km 4

93 georeferenced · 8 without coordinates

Open the mapobservation + sensor101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 31≤1 km 26≤10 km 23>10 km 3

83 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence123

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 10

10 georeferenced · 6 without coordinates

Open the mapnot free-living16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	26
Canberra, AU	26
Mount Annan, AU	23
Armidale, AU	20
Kew, GB	9
Museo Entomologico de Leonlocation not on record	5
Bronx, US	4
NSW Dept of Planning, Industry and Environmentlocation not on record	3
John T. Waterhouse Herbariumlocation not on record	2
Berlin, DE	2
Edinburgh, GB	2
Saint Louis, US	1

12 institutions · 123 of 123 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)