Callitris baileyi

C.T.White · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Cupressaceae/Callitris

At a glance

Occurrence records348

Data sources7

Biological traits26

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Callitris baileyi's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility348 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF348 records

DNA & barcodingNCBIsequences

01Narrative

Callitris baileyi is a species of conifer in the family Cupressaceae. It is found only in Australia, more specifically Southeast Queensland. Its common English name is Bailey's cypress-pine. The name is dedicated to Australian botanist Frederick Manson Bailey, who was the first to collect specimens of this tree. Bailey's name is closely associated with much of the flora of Queensland and their elucidation in Southeastern Queensland. Over the past few decades the conifer has been severely threatened by habitat loss Fruiting for the species has been recorded year-round. Frederick Manson Bailey : First individual to collect Callitris baileyi

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Fruit width11.5 mm

Leaf length2 mm

Leaf length max5 mm

Leaf length min2 mm

Leaf width1.5 mm

Plant height19 m

Seed length5 mm

Seed mass8.5 mg

Seed mass max8.49 mg

Seed mass min8.49 mg

Seed width3.5 mm

Life cycle & reproduction5

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typestrobilus

Growth formtree

Leaf compoundnesssimple

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callitris baileyi has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

The DNA barcodea real sequence read deposited for this species

rbcLLC405243.1 ↗1 254 bp

ACGT

TTATTATACTCCCGAATATCCGACCAAAGATACTGATATCTTAGCAGCCTTCCGCGTCACTCCCCAACCTGGAGTACCCCCCGAAGAAGC …

Callitris baileyi CRISP10153A chloroplast rbcL gene for ribulose bisphosphate carboxylase large chain, partial sequence, sequence_id: CRISP10153A_001

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL4

plant barcode

08Occurrence & distribution

Record type348 records

Wild obs. + sensor199

Museum / vouchered133

Cultivated / captive2

Other14

Origin

Native32

Range

Area of Occupancy AOO608 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 75≤1 km 4≤10 km 1>10 km 8

88 georeferenced · 111 without coordinates

Open the mapobservation + sensor199

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 54≤1 km 7≤10 km 45>10 km 10

116 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence133

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	62
Mount Annan, AU	32
Canberra, AU	11
Museo Entomologico de Leonlocation not on record	8
Kew, GB	7
John T. Waterhouse Herbariumlocation not on record	3
Armidale, AU	3
Honolulu, US	2
Adelaide, AU	2
Saint Louis, US	1
BISHlocation not on record	1

11 institutions · 132 of 133 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)