Callitriche truncata

Guss. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Callitriche

At a glance

Occurrence records1 841

Data sources11

Biological traits19

DNA specimens14

eDNA detections10

Sources11 archives

Databases and archives Callitriche truncata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 841 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources19 traits

Occurrence & distributionGBIF1 841 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD · NCBI14 specimens

Genome at a glanceCCDB · GoaT2n = 6

01Narrative

Callitriche truncata, the short leaved water starwort, is a species of plant in the family Plantaginaceae. They have a self-supporting growth form and simple, broad leaves. Individuals can grow to 10 cm tall.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTWCVP

Size & morphology4

Plant height0.1 m

Seed mass0.04 mg

⚠ sources differ — TRY: 0.04 mg · LEDA: 0.133 mg · GIFT: 0.132 mg

Seed mass max0.13 mg

Seed mass min0.13 mg

Life cycle & reproduction4

Life formhydrosubshrub

Life spanannual

Raunkiær life formtherophyte

Seed number4

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticaquatic

Climatesubtropical

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Tree

Woodinessnon-woody

Physiology & chemistry2

Photosynthetic pathwayC3

Seed longevity index0.75

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callitriche truncata has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes4

GenBank sequences10

eDNA detections10

Countries6

The DNA barcodea real sequence read deposited for this species

ITSMN091605.1 ↗675 bpGreece

ACGT

TAGGTGAACCTGCGGAAGGATCATTGTCGAAACTTTCAAAGTAGACCTGCGAACATGTGTTTAACTCACTCGGGTACTGCGGCTTGCCGG …

Callitriche truncata isolate C17_025 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Callitriche truncata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Ploidydiploid inferred

Chromosome records6–62n range6median6mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 611×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · nw-europe-fl · CCDB · book-ipcn67-71 +4

GoaT · DTOL Flowering Plants Estimates Kew

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3541

CCDB · book-ipcn67-71 — SCHOTSMAN, H. D. 1967. Les Callitriches. Especes de France et taxa nouveau d'Europe. Flore de France, Vol. 1: 1-152.

CCDB · book-fedorov — Dodds (T. 1935-1936)

CCDB · book-fedorov — Savidge 1960a

CCDB · book-fedorov — Schotsman 1961b

CCDB · book-atlas-flowering-plants — Dodds, T. 1937

CCDB · kew — Pijnacker LP, Schotsman HD. 1988. Nuclear DNA amounts in European Callitriche species (Callitrichaceae). Acta Botanica Neerlandica 37: 129-135.

CCDB · CromoCat 2015 — Schotsman, H. D. (1961a). Notes on some portugueses species of Callitriche. Bol. Soc. Brot. 35: 95-127.

CCDB · CromoCat 2015 — Schotsman, H. D. (1967). Les Callitriches. Especes de France et taxa nouveau d`Europe. Flore de France, 1: 1-152.

CCDB · CromoCat 2015 — Schotsman, H. D. (1977). Callitriches de la région méditerranéenne. Nouvelles observations. Bull. Centr. Études Rech. Sci. Biarritz 11: 241-312.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.994 ↗

08Occurrence & distribution

Record type1 841 records

Wild obs. + sensor1 675

Museum / vouchered146

Other20

Origin

Native556

Range

Area of Occupancy AOO2 412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy22% within 1 km

≤100 m 130≤1 km 202≤10 km 1 204>10 km 6

1 542 georeferenced · 133 without coordinates

Open the mapobservation + sensor1 675

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 5≤1 km 51≤10 km 28

84 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence146

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussel, BE	61
BIO-UNIPIlocation not on record	19
MeiseBGlocation not on record	7
Conservatoire botanique national du Bassin parisienlocation not on record	5
UIBlocation not on record	4
Barcelona, ES	3
Xiamen, CN	3
Salamanca, ES	3
National Museum Waleslocation not on record	3
Paris, FR	2
Aarhus, DK	2
San Isidro, AR	2
BSBIlocation not on record	1
GJOlocation not on record	1
Naturalis Biodiversity Centerlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Madrid, ES	1
Entomological Society of Latvialocation not on record	1
Museo Achille Folettolocation not on record	1
Herbario Universidad de Concepciónlocation not on record	1
SNSNMClocation not on record	1
Tilburg, NL	1
Corrientes, AR	1
Glocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
South Kensington, GB	1

26 institutions · 128 of 146 vouchered records shown · 18 without an institution code

09Environmental DNA10 detections

Where the DNA of Callitriche truncata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 15.8–17.2

Seasonal swing summer↔winter9.70 °C

Max temp (day)18.0 °C 18.0–20.6

Min temp (night)12.9 °C 12.9–13.6

Precipitation61.7 mm/mo 61.7–71.6

Air humidity64.6 % 62.0–64.6

Moisture balance-64.1 mm/mo -64.1–-34.3

Vapour deficit635 Pa 635–751

Wind speed4.70 m/s 3.30–4.70

Cloud cover49.8 % 41.9–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Callitriche truncata

At a glance

Sources11 archives

Size & morphology4

Life cycle & reproduction4

Diet & foraging1

Habitat & environment8

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 841 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 841 records