Callitriche terrestris — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Callitriche

At a glance

Occurrence records416

Data sources10

Biological traits15

DNA specimens2

eDNA detections1

Sources10 archives

Databases and archives Callitriche terrestris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility416 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF416 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 10

01Narrative

Боло́тник назе́мный — вид цветковых растений рода Болотник (лат. Callitriche) семейства Подорожниковые (лат. Plantaginaceae). Найден в Канаде и на востоке США. Водное растение.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formhydrosubshrub

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max500 m

Elevation mean1 950 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTRestinga

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callitriche terrestris has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLLC765363.1 ↗1 183 bpJapan · 2022

ACGT

AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGC …

Callitriche terrestris TI:00256642 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK7rbcL3ITS

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Callitriche terrestris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 101×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Philbrick, C. T. 1994. Chromosome counts for Callitriche (Callitrichaceae) in North America. Rhodora 96: 383–386.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type416 records

Wild obs. + sensor151

Museum / vouchered264

Other1

Origin

Native2

Range

Area of Occupancy AOO1 416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 74≤1 km 10≤10 km 6>10 km 33

123 georeferenced · 28 without coordinates

Open the mapobservation + sensor151

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 8≤1 km 73≤10 km 76>10 km 5

162 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence264

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions41 of 52 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	45
Odawara, JP	31
Bloomington, US	30
Chongqing Museumlocation not on record	19
Wuzhou, CN	18
University of Stellenboschlocation not on record	9
Chapel Hill, US	6
Columbia, US	6
Little Rock, US	6
Bronx, US	5
BAYLUlocation not on record	5
Fayetteville, US	5
Philadelphia, US	4
Austin, US	4
Tuscaloosa, US	4
Burlington, US	4
Fairfax, US	4
Herbarium of the Department of Botany, University of Tokyolocation not on record	3
College Park, US	3
US	3
Clemson, US	2
Riverside, US	2
San José, CR	2
Kochi, JP	2
GAlocation not on record	2
Salvador, BR	2
Vancouver, CA	2
Pontificia Universidad Javeriana (PUJ)location not on record	2
Sagamihara, JP	2
Madison, US	1
Saint Louis, US	1
Williamsburg, US	1
Dekalb, US	1
Denton, US	1
Ann Arbor, US	1
Chadron, US	1
Tampa, US	1
University of Southern Mississippilocation not on record	1
South Kensington, GB	1
Jackson, US	1
Lubbock, US	1
Lord Fairfax Community Collegelocation not on record	1
Córdoba, AR	1
UESBlocation not on record	1
Blacksburg, US	1
Denver, US	1
UFBAlocation not on record	1
Bando, JP	1
Mexico City, MX	1
Corrientes, AR	1
Baltimore, US	1
Wlocation not on record	1

52 institutions · 255 of 264 vouchered records shown · 9 without an institution code

09Environmental DNA1 detections

Where the DNA of Callitriche terrestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.