Callitriche marginata

Torr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Callitriche

At a glance

Occurrence records482

Data sources12

Biological traits10

DNA specimens7

eDNA detections3

Sources12 archives

Databases and archives Callitriche marginata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility482 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF482 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Callitriche marginata is a species of aquatic plant known by the common name winged water starwort. Callitriche marginata is native to the west coast of North America from British Columbia to Baja California, where it grows in and around vernal pools.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formhydrosubshrub

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callitriche marginata has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences3

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLKX679160.1 ↗552 bpCanada · 2009

ACGT

AGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCA …

Callitriche marginata voucher HERB0212 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Callitriche marginata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Philbrick, C. T. 1994. Chromosome counts for Callitriche (Callitrichaceae) in North America. Rhodora 96: 383–386.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type482 records

Wild obs. + sensor73

Museum / vouchered406

Other3

Origin

Native39

Range

Area of Occupancy AOO1 220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 49≤1 km 3>10 km 5

57 georeferenced · 16 without coordinates

Open the mapobservation + sensor73

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 37≤1 km 110≤10 km 71>10 km 1

219 georeferenced · 187 without coordinates

Open the institutions mapphysical evidence406

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	77
Claremont, US	44
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	34
San Luis Obispo, US	29
Santa Barbara, US	28
Davis, US	25
US	24
Riverside, US	19
Victoria, CA	14
Bronx, US	10
Severin-McDaniel Insect Collectionlocation not on record	8
Ensenada, MX	6
San Jose, US	4
Santa Cruz, US	4
WTUlocation not on record	3
CASlocation not on record	3
Mexico City, MX	3
Irvine, US	2
Bloomington, US	2
ASUlocation not on record	2
Wuzhou, CN	2
Vancouver, CA	2
Canadian Department of Agriculturelocation not on record	2
Los Angeles, US	2
Arizona State University Biocollectionslocation not on record	2
Museo Entomologico de Leonlocation not on record	1
Moscow, US	1
Northridge, US	1
San Diego Natural History Museum, Herbariumlocation not on record	1
University of British Columbia, Herbariumlocation not on record	1
Saint Louis, US	1
Fort Bragg, US	1
Arcata, US	1
San Francisco, US	1
Angwin, US	1
Boise, US	1
Canberra, AU	1

37 institutions · 363 of 406 vouchered records shown · 43 without an institution code

09Environmental DNA3 detections

Where the DNA of Callitriche marginata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

Coastal Sage Scrub/Riparian vegetation w Art…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 13.6–13.6

Seasonal swing summer↔winter11.2 °C

Max temp (day)18.1 °C 17.6–18.5

Min temp (night)9.40 °C 8.50–10.2

Precipitation48.2 mm/mo 38.8–57.6

Air humidity59.9 % 59.6–60.2

Moisture balance-61.2 mm/mo -82.4–-39.9

Vapour deficit624 Pa 618–630

Wind speed1.70 m/s 1.40–2.00

Cloud cover34.7 % 32.2–37.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)