Callitriche antarctica

Engelm. ex Hegelm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Callitriche

At a glance

Occurrence records431

Data sources10

Biological traits24

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Callitriche antarctica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility431 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF431 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Callitriche antarctica, commonly known as the Antarctic water-starwort, is a small, prostrate plant with tiny yellow flowers in the family Plantaginaceae (though sometimes placed in its own family – Callitrichaceae). It is found in wet places on many subantarctic islands and has a wide circumantarctic distribution, something reflected in its specific epithet.Flora of Australia Online.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology3

Leaf size108 mm²

Plant height0.095 m

Seed mass0.603 mg

Life cycle & reproduction4

Life formhydrosubshrub

Life spanperennial

⚠ sources differ — AusTraits: perennial · GIFT: annual

Raunkiær life formtherophyte

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticaquatic

Climatetemperate

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

Woodinessnon-woody

Physiology & chemistry6

Leaf dry-matter content (LDMC)164 mg/g

Leaf n32 mg/g

Leaf p6.43 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)37.9 mm²/mg

Wood density202 mg/cm³

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callitriche antarctica has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections2

Countries3

The DNA barcodea real sequence read deposited for this species

ITSLC177711.1 ↗706 bpUnited Kingdom

ACGT

GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTCCAAAGTAGACCCGCGAACACGTGTTT …

Callitriche antarctica genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence, specimen_voucher: K:39240

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Callitriche antarctica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–402n range40median40mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 405×CCDB · new-zealand · CCDB · book-fedorov · CCDB · kew +1

CCDB · new-zealand

CCDB · book-fedorov — Moore D. M. 1960

CCDB · book-fedorov — Beuzenberg, Hair 1963

CCDB · kew — Bennett MD, Smith JB, Lewis Smith RI. 1982. DNA amounts of angiosperms from the Antarctic and South Georgia. Environmental and Experimental Botany 22: 307-318.

CCDB · Cave1963 — Beuzen. & Hair 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type431 records

Wild obs. + sensor147

Museum / vouchered283

Other1

Origin

Native32

Range

Area of Occupancy AOO812 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 26≤1 km 102≤10 km 3>10 km 3

134 georeferenced · 13 without coordinates

Open the mapobservation + sensor147

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 3≤1 km 71≤10 km 31>10 km 9

114 georeferenced · 169 without coordinates

Open the institutions mapphysical evidence283

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	45
Kew, GB	34
Mount Annan, AU	32
AASlocation not on record	31
Paris, FR	25
Museo Entomologico de Leonlocation not on record	21
Canberra, AU	19
Wellington, NZ	17
AADClocation not on record	15
QVMAGlocation not on record	8
Adelaide, AU	7
Christchurch, NZ	4
San Isidro, AR	4
Auckland, NZ	4
Ciudad Autónoma de Buenos Aires, AR	2
Castelar, AR	2
South Kensington, GB	1
Parkville, AU	1
Honolulu, US	1
Görlitz, DE	1
Trondheim, NO	1
Pretoria, ZA	1
Saint Louis, US	1
Herbario Universidad de Concepciónlocation not on record	1
Brisbane, AU	1
Armidale, AU	1

26 institutions · 280 of 283 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Callitriche antarctica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)