Callistemon viridiflorus

(Sieber ex Sims) Sweet · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Callistemon

At a glance

Occurrence records693

Data sources7

Biological traits22

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Callistemon viridiflorus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility693 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF693 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Melaleuca virens, commonly known as lime bottlebrush, is a plant in the myrtle family, Myrtaceae and is endemic to Tasmania in Australia. (Some Australian state herbaria continue to use the name Callistemon viridiflorus.) It is one of only two melaleucas endemic to Tasmania, the other being Melaleuca pustulata although another six also occur there. A small to medium shrub growing mostly in subalpine areas, it has hard, leathery, sharply pointed leaves and spikes of yellow or greenish flowers in early summer,

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology7

Leaf length30 mm

Leaf size393 mm²

Leaf width7 mm

Plant height2.25 m

Seed mass0.1 mg

⚠ sources differ — TRY: 0.1 mg · AusTraits: 0.068 mg · GIFT: 0.1 mg

Seed mass max0.1 mg

Seed mass min0.1 mg

Life cycle & reproduction5

Deciduousnessevergreen

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callistemon viridiflorus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF294607.1 ↗297 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAATGACTAGAGAACGAGTAACAAACTCGATGGGGGCGGTGGGCTTCGCTCAACGTCCCCCGACGC …

Callistemon viridiflorus 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Callistemon viridiflorus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-ipcn65

CCDB · book-ipcn65 — Mousel 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type693 records

Wild obs. + sensor447

Museum / vouchered235

Cultivated / captive11

Origin

Native24

Range

Area of Occupancy AOO1 784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 286≤1 km 75≤10 km 79>10 km 7

447 georeferenced

Open the mapobservation + sensor447

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 8≤1 km 135≤10 km 59>10 km 13

215 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence235

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 9 without coordinates

Open the mapnot free-living11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	125
Canberra, AU	29
Mount Annan, AU	24
Museo Entomologico de Leonlocation not on record	20
QVMAGlocation not on record	11
Adelaide, AU	11
La Trobe Universitylocation not on record	7
Brisbane, AU	2
Rotorua, NZ	2
Armidale, AU	2
Parkville, AU	1
Riverside, US	1

12 institutions · 235 of 235 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)