Callistemon subulatus

Cheel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Callistemon

At a glance

Occurrence records376

Data sources5

Biological traits34

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Callistemon subulatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility376 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources34 traits

Occurrence & distributionGBIF376 records

DNA & barcodingNCBIsequences

01Narrative

Melaleuca subulata is a plant in the myrtle family Myrtaceae, and is endemic to south eastern Australia. (Some Australian state herbaria continue to use the name Callistemon subulatus). It is a small, spreading shrub with hard bark, dense foliage, cylindrical leaves and spikes of dark crimson flowers in summer.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology13

Fruit length4.5 mm

Fruit width4.5 mm

Leaf length40 mm

Leaf length max40 mm

Leaf length min20 mm

Leaf width3 mm

Leaf width max3 mm

Leaf width min2 mm

Plant height1 m

Plant height max1 m

Seed mass0.04 mg

⚠ sources differ — TRY: 0.04 mg · AusTraits: 0.066 mg · GIFT: 0.043 mg

Seed mass max0.066 mg

Seed mass min0.02 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typewind

Flowering timeyynnnnnnnnny

Life spanperennial

Pollination syndromeinsect+vertebrate

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear subulate terete

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callistemon subulatus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF048860.1 ↗280 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAATGACCAGAGAACCAGTAACAAACTCGATGGGGGCGGTGGGCTTTGCTCAACGTCCCCCGACGC …

Callistemon subulatus 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type376 records

Wild obs. + sensor176

Museum / vouchered196

Cultivated / captive4

Origin

Native35

Introduced2

Range

Area of Occupancy AOO860 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 106≤1 km 41≤10 km 21

168 georeferenced · 8 without coordinates

Open the mapobservation + sensor176

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 23≤1 km 59≤10 km 62>10 km 16

160 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence196

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1≤10 km 1

3 georeferenced · 1 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	53
Museo Entomologico de Leonlocation not on record	46
Mount Annan, AU	36
Quito, EC	19
La Trobe Universitylocation not on record	9
Wollongong, AU	6
Adelaide, AU	5
Batemans Bay, AU	4
Tampa, US	3
Brisbane, AU	2
Columbia, US	2
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Armidale, AU	2
Istituto Agrario Castelnuovolocation not on record	2
UTPLlocation not on record	1
WTUlocation not on record	1
QCNElocation not on record	1
Smithfield, AU	1

18 institutions · 195 of 196 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)