Callistemon salignus

(Sm.) Colvill ex Sweet · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Callistemon

At a glance

Occurrence records4 944

Data sources10

Biological traits43

DNA specimens6

eDNA detections6

Sources10 archives

Databases and archives Callistemon salignus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 944 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources43 traits

Occurrence & distributionGBIF4 944 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Melaleuca salicina, commonly known as willow bottlebrush, is a plant in the myrtle family Myrtaceae, and is endemic to eastern Australia. Some Australian state herbaria continue to use the name Callistemon salignus, a name that is accepted by the Australian Plant Census. It is a shrub or small tree with soft foliage, pink new growth, white papery bark and spikes of usually white or creamy bottlebrush flowers in spring.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology16

Fruit length4.5 mm

Fruit width4.5 mm

Leaf length75 mm

⚠ sources differ — AusTraits: 75 mm · GIFT: 67.5 mm

Leaf length max90 mm

Leaf length min60 mm

Leaf mass per area120 g/m2

Leaf size646 mm²

Leaf width9.5 mm

⚠ sources differ — AusTraits: 9.5 mm · GIFT: 7 mm

Leaf width max14 mm

Leaf width min5 mm

Plant height6 m

Plant height max15 m

Plant height min2 m

Seed mass0.03 mg

⚠ sources differ — TRY: 0.03 mg · AusTraits: 0.034 mg · GIFT: 0.026 mg

Seed mass max0.03 mg

Seed mass min0.02 mg

Life cycle & reproduction10

Deciduousnessevergreen

Flowering endNov

Flowering startSep

Flowering timennnnnnnnyynn

Life spanperennial

Lifespan years50 years

⚠ sources differ — TRY: 50 years · AusTraits: 40 years

Raunkiær life formphanerophyte

Reproductive maturity1 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)8.23 mm²/mg

Wood density839 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callistemon salignus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences10

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF048859.1 ↗280 bp

ACGT

ATCATTGTCGAATCCTGCATAGCAGAATGACCAGAGAACTAGTAACAAACTCGATGGGGGCGGTGGGCTTCGCTCAACGTCCCCCGACGC …

Callistemon salignus 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Callistemon salignus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · book-fedorov

CCDB · book-fedorov — Smith-White 1948a

CCDB · book-fedorov — Moussel 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 944 records

Wild obs. + sensor4 179

Museum / vouchered555

Cultivated / captive9

Other201

Origin

Native180

Introduced38

Range

Area of Occupancy AOO8 984 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 3 336≤1 km 506≤10 km 126>10 km 1

3 969 georeferenced · 210 without coordinates

Open the mapobservation + sensor4 179

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 57≤1 km 69≤10 km 224>10 km 84

434 georeferenced · 121 without coordinates

Open the institutions mapphysical evidence555

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy67% within 1 km

≤100 m 2≤1 km 2≤10 km 2

6 georeferenced · 3 without coordinates

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	182
Canberra, AU	74
Brisbane, AU	70
Museo Entomologico de Leonlocation not on record	61
Armidale, AU	30
Tampa, US	20
Rotorua, NZ	14
NSW Dept of Planning, Industry and Environmentlocation not on record	13
Auckland, NZ	12
La Trobe Universitylocation not on record	11
Wollongong, AU	7
Adelaide, AU	6
Kew, GB	4
Beijing, CN	3
Chicago, US	3
Saint Louis, US	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Mexico City, MX	2
Berlin, DE	2
Kunming, CN	2
Durango, MX	2
Jataí / Setor Industrial, BR	2
Antiguo Cuscatlán, SV	2
Smithfield, AU	2
PUC-RSlocation not on record	2
Parkville, AU	2
UNICAMPlocation not on record	1
Miami, US	1
South Kensington, GB	1
Palmerston, AU	1
Batemans Bay, AU	1
Pontifícia Universidade Católica do Paranálocation not on record	1
Maringá, BR	1
Yangling, CN	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Guilin, CN	1
Görlitz, DE	1
Ilhéus, BR	1
John T. Waterhouse Herbariumlocation not on record	1
UESBlocation not on record	1

40 institutions · 546 of 555 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Callistemon salignus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C

Min temp (night)19.3 °C

Precipitation109 mm/mo

Air humidity52.0 %

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa

Wind speed1.80 m/s

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Callistemon salignus

At a glance

Sources10 archives

Size & morphology16

Life cycle & reproduction10

Diet & foraging1

Habitat & environment11

Physiology & chemistry4

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 944 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions30 of 40 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 944 records