Callistemon rugulosus

(Link) DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Callistemon

At a glance

Occurrence records1 908

Data sources7

Biological traits36

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Callistemon rugulosus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 908 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources36 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF1 908 records

DNA & barcodingNCBIsequences

01Narrative

Melaleuca rugulosa, commonly known as scarlet bottlebrush, is a plant in the myrtle family, Myrtaceae and is endemic to South Australia and Victoria in Australia. (Some Australian state herbaria continue to use the name Callistemon rugulosus. Callistemon coccineus and Callistemon macropunctatus are older names for Callistemon rugulosus.) It is a shrub with an open straggly habit, stiff, sharply pointed leaves and bright red bottlebrush flowers tipped with yellow in summer.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology14

Fruit length7.5 mm

Fruit width7.5 mm

Leaf length50 mm

Leaf mass29.9 mg

Leaf mass per area333 g/m2

Leaf size94.19 mm²

Leaf width7 mm

Plant height4 m

Plant height max4 m

Seed length1.05 mm

Seed mass0.171 mg

⚠ sources differ — TRY: 0.171 mg · AusTraits: 0.14 mg · GIFT: 0.159 mg

Seed mass max0.188 mg

Seed mass min0.13 mg

Seed width0.37 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typewind

Flowering timennnnnnnnnyyy

Life spanperennial

Pollination syndromeinsect+vertebrate

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_oblanceolate

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)3.05 mm²/mg

Wood density799 mg/cm³

03Chemical composition1 compounds

Compounds documented for Callistemon rugulosus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Stigmastane steroids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
gamma-Sitosterol		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callistemon rugulosus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF048858.1 ↗278 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAATGACCAGAGAACTAGTAACAAACTCGATGGGGGCGGTNGGCTTTGCCCAACGACCCACGACGC …

Callistemon rugulosus 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type1 908 records

Wild obs. + sensor1 280

Museum / vouchered615

Cultivated / captive13

Origin

Native1 077

Introduced10

Range

Area of Occupancy AOO4 532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 324≤1 km 623≤10 km 271>10 km 12

1 230 georeferenced · 50 without coordinates

Open the mapobservation + sensor1 280

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 97≤1 km 156≤10 km 258>10 km 79

590 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence615

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy63% within 1 km

≤100 m 2≤1 km 3≤10 km 3

8 georeferenced · 5 without coordinates

Open the mapnot free-living13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	322
Museo Entomologico de Leonlocation not on record	90
Canberra, AU	74
Mount Annan, AU	39
La Trobe Universitylocation not on record	12
Parkville, AU	6
Brisbane, AU	6
Hobart, AU	5
Armidale, AU	3
EL PASO, US	2
Smithfield, AU	2
Kensington, AU	1
Tampa, US	1
Santa Barbara, US	1
Auckland, NZ	1
ASUlocation not on record	1

16 institutions · 566 of 615 vouchered records shown · 49 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Callistemon rugulosus

At a glance

Sources7 archives

Size & morphology14

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry4

Compound class profile1 class

Documented compounds1 total

At a glance

Record type1 908 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 16 geolocated

Cultivated / Captivenot free-living

Record type1 908 records