Callistemon pityoides

Miq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Callistemon

At a glance

Occurrence records5

Data sources6

Biological traits38

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Callistemon pityoides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources38 traits

Occurrence & distributionGBIF5 records

DNA & barcodingNCBIsequences

01Narrative

Melaleuca pityoides, commonly known as alpine bottlebrush, is a plant in the family Myrtaceae, and is endemic to the higher areas of south eastern Australia. Some Australian state herbaria continue to use the name Callistemon pityoides. It is a shrub, often occurring in dense thickets, with hard bark, silvery-grey new growth, almost cylindrical leaves and spikes of flowers that are usually a shade of yellow.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology13

Fruit length4 mm

Fruit width4 mm

Leaf length20 mm

Leaf length max20 mm

Leaf length min10 mm

Leaf width1.5 mm

Leaf width max1.5 mm

Leaf width min0.75 mm

Plant height3 m

Plant height max3 m

Seed mass0.246 mg

⚠ sources differ — TRY: 0.246 mg · AusTraits: 0.04 mg · GIFT: 0.25 mg

Seed mass max0.31 mg

Seed mass min0.19 mg

Life cycle & reproduction12

Deciduousnessevergreen

Dispersal typewind

Flowering endFeb

Flowering startNov

Flowering timeyynnnnnnnnyy

Life span>50

⚠ sources differ — TRY: >50 · AusTraits: perennial · GIFT: perennial

Lifespan years50 years

Pollination syndromeinsect+vertebrate

Raunkiær life formphanerophyte

Reproductive maturity5 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear terete

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callistemon pityoides has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF048855.1 ↗280 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAATGACCAGAGAACCAGTAACAAACTCGATGGGGGCGGTGGGCTTCGCTCAACGTCCCCCGACGC …

Callistemon pityoides 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type5 records

Wild obs. + sensor1

Museum / vouchered4

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
AUAlocation not on record	1
Santa Barbara, US	1
Auckland, NZ	1
Campo Mourão, BR	1

4 institutions · 4 of 4 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)