Callistemon phoeniceus

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Callistemon

At a glance

Occurrence records469

Data sources10

Biological traits21

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Callistemon phoeniceus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility469 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF469 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Melaleuca phoenicea, commonly known as scarlet bottlebrush or lesser bottlebrush, is a plant in the myrtle family, Myrtaceae and is endemic to the south-west of Western Australia. (Some Australian state herbaria continue to use the name Callistemon phoeniceus.) The Noongar peoples know the plant as tubada. It is a shrub with thick, blue-green leaves and spikes of scarlet bottlebrush flowers in spring and summer.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology6

Plant height3.5 m

Plant height max6 m

Plant height min1 m

Seed mass0.049 mg

⚠ sources differ — TRY: 0.049 mg · AusTraits: 0.035 mg · GIFT: 0.053 mg

Seed mass max0.13 mg

Seed mass min0.01 mg

Life cycle & reproduction5

Deciduousnessevergreen

Flowering timeynnnnnnnyyyy

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree · TRY: Shrub

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density846 mg/cm³

03Chemical composition2 compounds

Compounds documented for Callistemon phoeniceus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Gallotannins2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
3-Methylellagic acid		present	LOTUS
Ellagic acid		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callistemon phoeniceus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF048854.1 ↗278 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAATGACCAGAGAACTAGTAACAAACTCGATGGGGGCGGTTGGCTTTGCCCAACGTCCCACGACGC …

Callistemon phoeniceus 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Callistemon phoeniceus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-fedorov

CCDB · book-fedorov — Smith-White 1948a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type469 records

Wild obs. + sensor44

Museum / vouchered413

Cultivated / captive12

Origin

Native20

Introduced35

Range

Area of Occupancy AOO1 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 7≤1 km 32>10 km 1

40 georeferenced · 4 without coordinates

Open the mapobservation + sensor44

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 45≤1 km 44≤10 km 217>10 km 33

339 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence413

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy67% within 1 km

≤1 km 4≤10 km 1>10 km 1

6 georeferenced · 6 without coordinates

Open the mapnot free-living12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	141
La Trobe Universitylocation not on record	95
Canberra, AU	53
Museo Entomologico de Leonlocation not on record	46
Mount Annan, AU	24
Tampa, US	9
Brisbane, AU	9
Adelaide, AU	9
BGPAlocation not on record	8
MAlocation not on record	3
Riverside, US	2
Hobart, AU	2
Stockholm, SE	1
Taipei, TW	1
John T. Waterhouse Herbariumlocation not on record	1
Kew, GB	1
Rotorua, NZ	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Auckland, NZ	1
Smithfield, AU	1
Palmerston, AU	1

21 institutions · 410 of 413 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)