Callistemon pearsonii

R.D.Spencer & Lumley · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Callistemon

At a glance

Occurrence records73

Data sources5

Biological traits12

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Callistemon pearsonii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility73 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF73 records

DNA & barcodingNCBIsequences

01Narrative

Melaleuca pearsonii, commonly known as Blackdown bottlebrush, is a plant in the myrtle family, Myrtaceae and is endemic to Queensland in Australia. (Some Australian state herbaria continue to use the name Callistemon pearsonii.) It is a small, spreading but compact shrub with hard bark, soft foliage and profuse spikes of bottlebrush flowers in spring and summer.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYAusTraitsGIFT

Size & morphology1

Seed mass0.071 mg

Life cycle & reproduction3

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callistemon pearsonii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF048853.1 ↗279 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAATGACCAGAGAACTAGTAACAAACTCGATGGGGGCGGTGGGCTTCGCTCAACGTCCCCCGACGC …

Callistemon pearsonii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type73 records

Museum / vouchered67

Cultivated / captive5

Other1

Origin

Native15

Introduced3

Range

Area of Occupancy AOO96 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 17≤1 km 10≤10 km 19>10 km 17

63 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence67

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy75% within 1 km

≤100 m 1≤1 km 2≤10 km 1

4 georeferenced · 1 without coordinates

Open the mapnot free-living5

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	23
Mount Annan, AU	17
Canberra, AU	11
Museo Entomologico de Leonlocation not on record	9
James Cook Townsvillelocation not on record	5
Armidale, AU	1
Adelaide, AU	1

7 institutions · 67 of 67 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)