Callistemon pachyphyllus

Cheel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Callistemon

At a glance

Occurrence records1 193

Data sources7

Biological traits34

DNA specimens0

eDNA detections2

Sources7 archives

Databases and archives Callistemon pachyphyllus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 193 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources34 traits

Occurrence & distributionGBIF1 193 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingNCBIsequences

01Narrative

Melaleuca pachyphylla, commonly known as wallum bottlebrush, is a plant in the myrtle family Myrtaceae, and is endemic to near-coastal regions of New South Wales and Queensland in Australia. (Some Australian state herbaria use the name Callistemon pachyphyllus, which is still widely used in the literature). It is a medium-sized shrub with a straggling habit and red, or sometimes greenish, bottlebrush flowers in summer.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology13

Leaf length67.5 mm

Leaf length max90 mm

Leaf length min45 mm

Leaf mass per area172 g/m2

Leaf size398 mm²

Leaf width6 mm

Leaf width max9 mm

Leaf width min3 mm

Plant height1.5 m

Plant height max1.5 m

Seed mass0.02 mg

⚠ sources differ — TRY: 0.02 mg · AusTraits: 0.036 mg · GIFT: 0.023 mg

Seed mass max0.036 mg

Seed mass min0.01 mg

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timeyynnnnnnnnny

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_oblanceolate

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)5.96 mm²/mg

Wood density524 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callistemon pachyphyllus has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAF048851.1 ↗278 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAATGACCAGAGAACTAGTAACAAACTCGATGGGGGCGGTGGGCTTTGCCCAACGTCCCACGACGC …

Callistemon pachyphyllus 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type1 193 records

Wild obs. + sensor683

Museum / vouchered417

Cultivated / captive12

Other81

Origin

Native116

Introduced9

Range

Area of Occupancy AOO2 216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 595≤1 km 51≤10 km 20>10 km 2

668 georeferenced · 15 without coordinates

Open the mapobservation + sensor683

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 37≤1 km 77≤10 km 202>10 km 50

366 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence417

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy55% within 1 km

≤100 m 1≤1 km 5≤10 km 5

11 georeferenced · 1 without coordinates

Open the mapnot free-living12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	125
Brisbane, AU	123
Canberra, AU	72
Armidale, AU	30
Museo Entomologico de Leonlocation not on record	23
Adelaide, AU	10
La Trobe Universitylocation not on record	8
Kew, GB	7
NSW Dept of Planning, Industry and Environmentlocation not on record	6
Tampa, US	3
Smithfield, AU	3
Hobart, AU	2
Wollongong, AU	1
Kensington, AU	1
Miami, US	1
Madison, US	1

16 institutions · 416 of 417 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Callistemon pachyphyllus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 21.1–23.6

Seasonal swing summer↔winter14.8 °C

Max temp (day)28.1 °C 26.2–30.0

Min temp (night)16.9 °C 16.6–17.2

Precipitation48.4 mm/mo 25.2–71.6

Air humidity54.4 % 51.2–57.5

Moisture balance-78.3 mm/mo -95.1–-61.4

Vapour deficit1,250 Pa 1,068–1,432

Wind speed2.10 m/s 2.00–2.10

Cloud cover18.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Callistemon pachyphyllus

At a glance

Sources7 archives

Size & morphology13

Life cycle & reproduction6

Diet & foraging1

Habitat & environment9

Physiology & chemistry4

Other traits1

At a glance

Record type1 193 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 193 records