Callistemon linearis

(Schrad. & J.C.Wendl.) Colvill ex Sweet · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Callistemon

At a glance

Occurrence records2 872

Data sources10

Biological traits46

DNA specimens4

eDNA detections4

Sources10 archives

Databases and archives Callistemon linearis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 872 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources46 traits

Chemical compositionLOTUS27 compounds

Occurrence & distributionGBIF2 872 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceGoaTgenome

01Narrative

Melaleuca linearis, commonly known as narrow-leaved bottlebrush, is a plant in the myrtle family, Myrtaceae and is endemic to New South Wales and Queensland in Australia. It is a medium-sized shrub with narrow leaves with a rigid point, and red flower spikes in late spring or early summer.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology18

Fruit length6 mm

⚠ sources differ — AusTraits: 6 mm · GIFT: 5 mm

Fruit length max5 mm

Fruit length min5 mm

Fruit width8.5 mm

⚠ sources differ — AusTraits: 8.5 mm · GIFT: 7 mm

Fruit width max7 mm

Fruit width min7 mm

Leaf length60 mm

⚠ sources differ — AusTraits: 60 mm · GIFT: 70 mm

Leaf length max160 mm

Leaf length min0.5 mm

Leaf width3 mm

⚠ sources differ — AusTraits: 3 mm · GIFT: 4 mm

Leaf width max6 mm

Leaf width min0.5 mm

Plant height2 m

Plant height max5 m

Plant height min0.6 m

Seed mass0.03 mg

⚠ sources differ — TRY: 0.03 mg · AusTraits: 0.036 mg · GIFT: 0.031 mg

Seed mass max0.046 mg

Seed mass min0.02 mg

Life cycle & reproduction12

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typewater+wind

⚠ sources differ — AusTraits: anemochory hydrochory · GIFT: unspecialized

Flowering timennnnnnnnnyyn

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect+vertebrate

⚠ sources differ — AusTraits: insect vertebrate · GIFT: bird

Raunkiær life formphanerophyte

Reproduction asexualabsent

Reproductive maturity3 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climberself-supporting

Elevation max750 m

Elevation min550 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Habitat GIFTCoastal

Leaf compoundnesssimple

Leaf shapelinear

Mycorrhizapresent

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition27 compounds

Compounds documented for Callistemon linearis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aromadendrane sesquiterpenoids5

Monocyclic monoterpenoids4

Acyclic monoterpenoids4

Menthane monoterpenoids $ Monocyclic monoterpenoids3

Thujane monoterpenoids2

Documented compounds27 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-1(10),4-Cadinadiene	present	LOTUS
(1aS,4aS,7aS,7bR)-1,1,7-trimethyl-4-methylidene-2,3,4a,5,6,7,7a,7b-octahydro-1aH-cyclopropa[e]azulene	present	LOTUS
(1aS,4aS,7S,7aR,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,4a,5,6,7a,7b-octahydrocyclopropa[h]azulen-7-ol	present	LOTUS
1-Isopropyl-4-methylbenzene	present	LOTUS
4(10)-Thujene	present	LOTUS
4-Methyl-2-propan-2-ylhexanoic acid	present	LOTUS
7-Methyl-3-methylene-1,6-octadiene	present	LOTUS
alpha Thujene	present	LOTUS
alpha-Terpineol	present	LOTUS
beta-Phellandrene	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callistemon linearis has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ182844.1 ↗265 bpAustralia · 1994

ACGT

GAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGTAACCATCCGGTGAGGGCACGTTTGCCTGGGTGTCACAC …

Melaleuca linearis var. pinifolia voucher BRI AQ634186 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★ITS6

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Callistemon linearis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 872 records

Wild obs. + sensor2 140

Museum / vouchered706

Cultivated / captive19

Other7

Origin

Native342

Introduced35

Range

Area of Occupancy AOO4 876 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 1 691≤1 km 327≤10 km 80>10 km 10

2 108 georeferenced · 32 without coordinates

Open the mapobservation + sensor2 140

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 101≤1 km 138≤10 km 281>10 km 59

579 georeferenced · 127 without coordinates

Open the institutions mapphysical evidence706

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy71% within 1 km

≤100 m 8≤1 km 2≤10 km 4

14 georeferenced · 5 without coordinates

Open the mapnot free-living19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	358
Canberra, AU	103
Armidale, AU	55
Brisbane, AU	46
Museo Entomologico de Leonlocation not on record	44
La Trobe Universitylocation not on record	14
Auckland, NZ	14
NSW Dept of Planning, Industry and Environmentlocation not on record	11
Wollongong, AU	10
Rotorua, NZ	10
Adelaide, AU	8
Central China Normal Universitylocation not on record	6
Hobart, AU	5
Tampa, US	4
Kensington, AU	4
Cambridge University Herbariumlocation not on record	2
John T. Waterhouse Herbariumlocation not on record	2
Baroda, IN	1
Miami, US	1
Brasília, BR	1
Smithfield, AU	1
Valparaiso, CL	1
Kew, GB	1
UEMlocation not on record	1
Batemans Bay, AU	1

25 institutions · 704 of 706 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Callistemon linearis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Callistemon linearis

At a glance

Sources10 archives

Size & morphology18

Life cycle & reproduction12

Diet & foraging1

Habitat & environment13

Physiology & chemistry2

Compound class profile5 classes

Documented compounds27 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 872 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 872 records