Callistemon acuminatus

Cheel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Callistemon

At a glance

Occurrence records144

Data sources8

Biological traits29

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Callistemon acuminatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility144 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources29 traits

Occurrence & distributionGBIF144 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Melaleuca flammea, commonly known as tapering-leaved bottlebrush, is a plant in the myrtle family, Myrtaceae and is endemic to New South Wales and Queensland in Australia. (The Australian Plant Census and some Australian state herbaria continue to use the name Callistemon acuminatus.) It is a shrub with broad, lance-shaped leaves which have wavy edges and taper gradually to a fine point. In spring it has typical bottlebrush flowers whose fiery colour gives the species its name.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology11

Fruit width5.5 mm

Leaf length75 mm

Leaf length max110 mm

Leaf length min40 mm

Leaf width10 mm

Leaf width max12 mm

Leaf width min8 mm

Plant height2 m

Plant height max3 m

Plant height min1 m

Seed mass0.028 mg

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timennnnnnnnyyyn

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical narrowly_lanceolate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callistemon acuminatus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF048850.1 ↗280 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAATGACCAGAGAACCAGTAACAAACTCGATGGGGGCGGTGGGCTTCGCTCAACGTCCCCCGACGC …

Callistemon acuminatus 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Callistemon acuminatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-fedorov

CCDB · book-fedorov — Smith-White 1948a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type144 records

Wild obs. + sensor42

Museum / vouchered96

Cultivated / captive6

Origin

Native35

Introduced8

Range

Area of Occupancy AOO300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 32≤1 km 1

33 georeferenced · 9 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 17≤1 km 27≤10 km 21>10 km 4

69 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence96

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 2 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	43
Canberra, AU	16
NSW Dept of Planning, Industry and Environmentlocation not on record	10
Museo Entomologico de Leonlocation not on record	5
Brisbane, AU	4
Armidale, AU	4
Universidade Federal do Rio Grande do Nortelocation not on record	2
Tampa, US	2
Riverside, US	2
John T. Waterhouse Herbariumlocation not on record	1
Ensenada, MX	1
Adelaide, AU	1
Saint Louis, US	1
San Diego, US	1

14 institutions · 93 of 96 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)