Callistachys lanceolata

Vent. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Callistachys

At a glance

Occurrence records709

Data sources10

Biological traits36

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Callistachys lanceolata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility709 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF709 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Callistachys lanceolata, commonly known as the wonnich or native willow, is a species of tree that is native to the South West of Australia. C. lanceolota has the synonym Oxylobium lanceolatum.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length12.5 mm

⚠ sources differ — AusTraits: 12.5 mm · GIFT: 15 mm

Leaf length95 mm

Leaf length max48 mm

Leaf width14.5 mm

⚠ sources differ — AusTraits: 14.5 mm · GIFT: 48 mm

Leaf width max48 mm

Leaf width min48 mm

Petiole length0.5 cm

Plant height7 m

Plant height max8 m

Plant height min1.5 m

Seed length2 mm

Seed mass2.64 mg

⚠ sources differ — TRY: 2.64 mg · AusTraits: 2.98 mg

Life cycle & reproduction11

Deciduousnessevergreen

Dispersal typeunspecialized

Life formshrub

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproduction asexualabsent

Reproductive maturity2 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typelegume

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree · TRY: shrub/tree

Habitat GIFTCoastal

Leaf compoundnesssimple

Leaf shapeelliptical narrowly_ovate oblong ovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition1 compounds

Compounds documented for Callistachys lanceolata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Fluoroacetic acid		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callistachys lanceolata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences10

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSU62599.1 ↗206 bp

ACGT

GGATCCCATCAGAACTTCGCAGATAAGCGTGCTTGGGCGAGAGTAGTACTAGGATAGGTGACCTCTTGGGAAGTCCTCGTGTTGCACATT …

Callistachys lanceolata nuclear 5S ribosomal RNA gene, partial sequence, internal transcribed spacer, complete sequence, and 5S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★ITS7

plant barcodefungal barcode

08Occurrence & distribution

Record type709 records

Wild obs. + sensor318

Museum / vouchered381

Cultivated / captive10

Origin

Native27

Introduced53

Range

Area of Occupancy AOO1 604 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 173≤1 km 60≤10 km 19>10 km 18

270 georeferenced · 48 without coordinates

Open the mapobservation + sensor318

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 42≤1 km 41≤10 km 155>10 km 28

266 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence381

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the mapnot free-living10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	147
Museo Entomologico de Leonlocation not on record	66
Auckland, NZ	38
Canberra, AU	32
Mount Annan, AU	31
Adelaide, AU	14
Christchurch, NZ	12
Hobart, AU	11
Wellington, NZ	10
Rotorua, NZ	6
Brisbane, AU	5
BGPAlocation not on record	4
Armidale, AU	2
Parkville, AU	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1

15 institutions · 380 of 381 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Callistachys lanceolata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)