Callisia ornata

(Small) G.C.Tucker · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Commelinaceae/Callisia

At a glance

Occurrence records770

Data sources6

Biological traits10

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Callisia ornata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility770 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF770 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 12

01Narrative

Callisia ornata là một loài thực vật có hoa trong họ Commelinaceae. Loài này được (Small) G.C.Tucker mô tả khoa học đầu tiên năm 1989.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanannual

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callisia ornata has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG640013.1 ↗596 bpUSA

ACGT

GAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCGAGAACGGACGACCGCGAACTGTTGAAACCGGG …

Callisia ornata voucher Molgo_350 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS8

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Callisia ornata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome records12–362n range24median12mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 121×CCDB · Automatic manuscript search

CCDB · Automatic manuscript search — Iwan E. Molgo,D. Soltis and P. Soltis. 2017. "Cytogeography of Callisia section Cuthbertia (Commelinaceae)". Comparative Cytogenetics 11:553-577.

2n 241×CCDB · Automatic manuscript search

CCDB · Automatic manuscript search — Iwan E. Molgo,D. Soltis and P. Soltis. 2017. "Cytogeography of Callisia section Cuthbertia (Commelinaceae)". Comparative Cytogenetics 11:553-577.

2n 361×CCDB · Automatic manuscript search

CCDB · Automatic manuscript search — Iwan E. Molgo,D. Soltis and P. Soltis. 2017. "Cytogeography of Callisia section Cuthbertia (Commelinaceae)". Comparative Cytogenetics 11:553-577.

08Occurrence & distribution

Record type770 records

Wild obs. + sensor686

Museum / vouchered84

Range

Area of Occupancy AOO1 476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 383≤1 km 96≤10 km 26>10 km 39

544 georeferenced · 142 without coordinates

Open the mapobservation + sensor686

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 4≤10 km 1>10 km 1

6 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	68
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	8
Bloomington, US	5
Northridge, US	1
Mississippi State, US	1
University of Southern Mississippilocation not on record	1

6 institutions · 84 of 84 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)