Callisia gentlei

Matuda · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Commelinaceae/Callisia

At a glance

Occurrence records19

Data sources8

Biological traits10

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Callisia gentlei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility19 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF19 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 12

01Narrative

Callisia gentlei is a species of flowering plant in the spiderwort family, Commelinaceae, that is native to southern Mexico, Guatemala, Belize, and Honduras.Kew World Checklist of Selected Plant FamiliesBalick, M. J., M. H. Nee & D.E. Atha. 2000. Checklist of the vascular plants of Belize. Mem. New York Bot. Gard. 85: i–ix, 1–246García-Mendoza, A. J. & J. Meave del Castillo. 2011. Diversidad Florística de Oaxaca: de Musgos a Angispermas 1–351. Universidad Nacional Autónoma de México, Ciudad Universitaria Varieties Callisia gentlei var. elegans (Alexander ex H.E.Moore) D.R.Hunt (syn. C. elegans Alexander ex H.E.Moore) - Oaxaca, Chiapas, Guatemala, Honduras Callisia gentlei var. gentlei - Belize, Yucatán Peninsula Callisia gentlei var. macdougallii (Miranda) D.R.Hunt - Chiapas

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formsucculent subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callisia gentlei has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG639919.1 ↗586 bpMexico

ACGT

GTAACAAGGTTTCCGTAGGTAAACCTGGGGAAGTATCATTATCGAATCCCAGAACGGACGACCGTGAACCGTCGAAACTGGGGTGTGCCC …

Callisia gentlei var. macdougallii voucher Molgo_359 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Callisia gentlei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome records12–122n range12median12mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 126×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +2

CCDB · book-ipcn65 — Guervin & LeCoq 1965

CCDB · ipcn-api-dl — Weryszko-Chmielewska, E. 1988. Analyis of the karyotype of Callisia elegans Alexand. (Commelinaceae) including differential staining of chromosomes. Acta Soc. Bot. Poloniae 57: 317–327.

CCDB · ipcn-api-dl — Begum, R. & M. A. Zaman. 1980. Cytogenetics of the Commelinaceae. X. Karyomorphology and meiotic behaviour of Callisia elegans Alexander. Bangladesh J. Bot. 9: 92–96.

CCDB · book-ipcn72 — JONES, K., & c. JOPLING. 1972. Chromosomes and the classification of the Commelinaceae. Bot. J. Linn. Soc. 65: 129-162.

CCDB · book-fedorov — Guervin, LeCoq 1965. 1966b

CCDB · kew — Bennett MD, Smith JB. 1976. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 274: 227-274.

n 63×CCDB · book-ipcn65 · CCDB · book-ipcn67-71

CCDB · book-ipcn65 — Guervin & LeCoq 1965

CCDB · book-ipcn67-71 — HEITZ, B. 1968. Commelinacees II. Inf. Ann. Caryosyst. et Cytogenet. 2: 26-32.

CCDB · book-ipcn67-71 — HEITZ, B. 1967 Cornrnelinacees. Inf. Ann. Caryosyst. et Cytogenet. 1: 17-21.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type19 records

Wild obs. + sensor1

Museum / vouchered17

Other1

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 11≤10 km 1

12 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	7
Austin, US	2
Austin, US	2
Durango, MX	2
Millersville, US	1
Bronx, US	1
Tuxtla Gutiérrez, MX	1

7 institutions · 16 of 17 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)