Calligonum comosum

L'Hér. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Polygonaceae/Calligonum

At a glance

Occurrence records1 085

Data sources10

Biological traits22

DNA specimens24

eDNA detections24

Sources10 archives

Databases and archives Calligonum comosum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 085 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF1 085 records

Environmental DNA1 datasets · 0 countries24 detections

DNA & barcodingBOLD · NCBI24 specimens

Genome at a glanceCCDB · GoaT1.7 Gbp

01Narrative

Calligonum mejidum là một loài thực vật có hoa trong họ Rau răm. Loài này được Al-Khayat mô tả khoa học đầu tiên năm 1988.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height0.8 m

Seed mass24.13 mg

⚠ sources differ — TRY: 24.13 mg · GIFT: 22.24 mg

Seed mass max39.29 mg

Seed mass min17.55 mg

Life cycle & reproduction7

Dispersal typewind

Flowering endApr

Flowering startMar

Life formsubshrub or shrub

Life spanperennial

Lifespan years11 years

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 000 m

Elevation min500 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calligonum comosum has left across the world's sequence archives.

At a glance

DNA specimens24

Marker genes3

GenBank sequences10

eDNA detections24

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLKX282629.1 ↗510 bpKuwait

ACGT

AGCTGGTGTTAAAGAATACAANTTGACTTATTATACTCCTGACTATGAACCCCATGATCATGATATCTTGGCAGCATTTCGAGTAACTCC …

Calligonum comosum voucher EDNA15-0042705 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Calligonum comosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 743 285 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Calligonum comosum1.74 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidy2× diploid · measured

Chromosome records18–362n range36median36mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 362×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn73-74

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-ipcn73-74 — VALOVICH, E.M., & Y.D. SOSKOV. 1973. The chromosome numbers of specj I of the genus Calligonum L. (in Russian) Bot. Zurn. (Moscow & Leningrad[, 58: 554-561.

2n 181×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Aparicio Martínez, A. 1989. Números cromosomáticos de plantas occidentales, 487--507. Anales Jard. Bot. Madrid 45: 483–494.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 085 records

Wild obs. + sensor1 014

Museum / vouchered65

Cultivated / captive4

Other2

Range

Area of Occupancy AOO1 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 61≤1 km 12≤10 km 62>10 km 3

138 georeferenced · 876 without coordinates

Open the mapobservation + sensor1 014

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤1 km 2≤10 km 7>10 km 5

15 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence65

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
PRClocation not on record	8
BClocation not on record	5
Edinburgh, GB	5
RABATlocation not on record	4
Rishon Le Zion, IL	4
Berlin, DE	4
Kew, GB	4
MeiseBGlocation not on record	4
University of Stellenboschlocation not on record	3
BRNUlocation not on record	2
Wlocation not on record	2
Lanzhou Institute of Desert Research, Academia Sinicalocation not on record	1
Moscow State Universitylocation not on record	1
Frankfurt am Main	1
València, ES	1
Natural History Museum Rotterdamlocation not on record	1
Uppsala, SE	1
LDlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

19 institutions · 53 of 65 vouchered records shown · 12 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA24 detections

Where the DNA of Calligonum comosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Calligonum comosum

At a glance

Sources10 archives

Size & morphology4

Life cycle & reproduction7

Diet & foraging1

Habitat & environment8

Physiology & chemistry1

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 085 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions7 of 19 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 085 records