Callicorixa praeusta

(Fieber, 1848) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Corixidae/Callicorixa

At a glance

Occurrence records7 820

Data sources7

Biological traits1

DNA specimens48

eDNA detections41

Sources7 archives

Databases and archives Callicorixa praeusta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 820 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF7 820 records

Environmental DNA1 datasets · 5 countries41 detections

DNA & barcodingBOLD48 specimens

01Narrative

Callicorixa praeusta is a species of Corixidae or water boatman, in the order Hemiptera.Tree of Life Web Project. 2005

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (larval)saprophagous

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callicorixa praeusta has left across the world's sequence archives.

At a glance

DNA specimens48

BINs3

Marker genes2

eDNA detections41

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 61 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

4Amostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

13Tmostly conserved

14Amostly conserved

15Tmostly conserved

17Tmostly conserved

19Cmostly conserved

20Gmostly conserved

22Tmostly conserved

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

26Tmostly conserved

28Gmostly conserved

29Tmostly conserved

30Cmostly conserved

31Amostly conserved

33Gmostly conserved

34Tmostly conserved

35Amostly conserved

36Tmostly conserved

38Gmostly conserved

39Tmostly conserved

40Amostly conserved

41Gmostly conserved

42Gmostly conserved

44Amostly conserved

45Cmostly conserved

46Amostly conserved

47Tmostly conserved

48Cmostly conserved

49Amostly conserved

50Cmostly conserved

51Tmostly conserved

52Tmostly conserved

53Amostly conserved

54Gmostly conserved

56Tmostly conserved

57Gmostly conserved

58Amostly conserved

59Tmostly conserved

60Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

70Tmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

80Cmostly conserved

81Amostly conserved

262Amostly conserved

373Amostly conserved

625Gmostly conserved

628Amostly conserved

AACATTATATTTTATTTTCGGTATTTGGTCAGGTATAGTAGGAACATCACTTAGATGATTAATTCGAATTGAATTAGGACAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes7

BINs3

Most divergent pair2.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Callicorixa productasame genus2.7%Callicorixa wollastonisame genus3.0%Callicorixa alaskensissame genus4.3%Callicorixa audenisame genus5.2%Sigara solensissame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCYTB

animal barcodemitochondrial

08Occurrence & distribution

Record type7 820 records

Wild obs. + sensor6 818

Museum / vouchered947

Other55

Range

Area of Occupancy AOO14 464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 4 458≤1 km 527≤10 km 1 579>10 km 4

6 568 georeferenced · 250 without coordinates

Open the mapobservation + sensor6 818

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 464≤1 km 178≤10 km 95>10 km 1

738 georeferenced · 209 without coordinates

Open the institutions mapphysical evidence947

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	146
NTNU-VMlocation not on record	124
NHMOlocation not on record	99
Jyväskylä, FI	66
Uniwersytet Łódzkilocation not on record	44
CBDClocation not on record	43
Stockholm, SE	38
Tartu, EE	36
BioFokuslocation not on record	36
Nijmegen, NL	26
Tilburg, NL	19
Philadelphia, US	15
ZMAAlocation not on record	12
John May Museum of Natural Historylocation not on record	8
South Kensington, GB	6
Tallinn, EE	4
Tromsø, NO	4
Natural History Museum, Londonlocation not on record	3
Helsinki, FI	2
Natural History Museum Rotterdamlocation not on record	2
Kuopio, FI	2
DEMNA-DNElocation not on record	1
GMBRClocation not on record	1
ZSMlocation not on record	1

24 institutions · 738 of 947 vouchered records shown · 209 without an institution code

09Environmental DNA41 detections

Where the DNA of Callicorixa praeusta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.30 °C 3.90–16.2

Seasonal swing summer↔winter16.1 °C

Max temp (day)9.50 °C 8.80–20.0

Min temp (night)3.20 °C -1.40–11.7

Precipitation67.8 mm/mo 51.7–90.4

Air humidity62.7 % 58.3–63.0

Moisture balance9.90 mm/mo -59.4–15.0

Vapour deficit393 Pa 333–728

Wind speed4.20 m/s 2.20–5.00

Cloud cover49.6 % 36.4–52.8

CHELSA 1981–2010, ~9 km grid, at location & month of 38 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Callicorixa praeusta

At a glance

Sources7 archives

Diet & foraging1

At a glance

Record type7 820 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 820 records