Callicladium imponens

(Hedw.) Hedenäs, Schlesak & D.Quandt · species

image placeholder — illustration coming later

Plantae/Bryophyta/Bryopsida/Hypnales/Callicladiaceae/Callicladium

At a glance

Occurrence records6 019

Data sources6

Biological traits1

DNA specimens27

eDNA detections19

Sources6 archives

Databases and archives Callicladium imponens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 019 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF6 019 records

Environmental DNA1 datasets · 1 countries19 detections

DNA & barcodingBOLD27 specimens

Genome at a glanceCCDB289 Mbp

01Narrative

Goudklauwtjesmos is een soort mos uit het geslacht klauwtjesmos (Hypnum). Het is een weinig algemene soort van natte heide in het Noord-Atlantisch gebied, die ook in België en Nederland zeldzaam voorkomt.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formnonvascular

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callicladium imponens has left across the world's sequence archives.

At a glance

DNA specimens27

Marker genes7

eDNA detections19

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 566 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BINs0

ATGAACAATTTTGCACAAAGATGGCTGTTTTCCACGAACCACAAAGATATAGGGACTCTATATTGCATTTTTGGTGCCATTGCTGGAGTT …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL★rbcLa★trnL★trnL-F★ITS★ITS2

animal barcodeplant barcodefungal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_024516 ↗ · 40 protein · 24 tRNA · 3 rRNA

cox1atp4atp8rps1rps2ccmBccmCccmFNccmFCrps4tatCnad4Lsdh4sdh3rpl10nad5nad4nad2rps12rps7atp6nad6cox2cox3nad1cob+17

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceCCDB

The complete instruction manual Callicladium imponens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size288 510 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Callicladium imponens0.29 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 71×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ireland, R. R. 1991. Chromosome studies on some mosses of Ontario and Québec. Bryologist 94: 30–38.

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Danilkiv, I. S. & O. V. Lobachevskaya. 1988. Chromosome numbers of species of leafy mosses from the USSR territory. Ukrajins'k. Bot. Žurn. 45: 52–54.

08Occurrence & distribution

Record type6 019 records

Wild obs. + sensor5 622

Museum / vouchered397

Range

Area of Occupancy AOO16 688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 3 326≤1 km 597≤10 km 271>10 km 301

4 495 georeferenced · 1 127 without coordinates

Open the mapobservation + sensor5 622

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 67≤1 km 158≤10 km 68>10 km 18

311 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence397

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oulu, FI	71
Oregon State Universitylocation not on record	64
SLU Artdatabankenlocation not on record	63
Kuopio, FI	41
Trondheim, NO	40
Brussel, BE	31
Olocation not on record	20
Turku, FI	15
Knoxville, US	14
Cambridge, US	10
Moscow State Universitylocation not on record	5
Helsinki, FI	5
BioFokuslocation not on record	2
nbflocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Fort Hayslocation not on record	1
Canadian Museum of Nature, Natural Heritage Collectionlocation not on record	1
CASlocation not on record	1
MeiseBGlocation not on record	1
Wlocation not on record	1
Christchurch, NZ	1
Saint Louis, US	1
Madison, US	1

23 institutions · 393 of 397 vouchered records shown · 4 without an institution code

09Environmental DNA19 detections

Where the DNA of Callicladium imponens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map1 country0

on boulder. Coniferous closed crown forest. …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 15.8–15.8

Seasonal swing summer↔winter24.1 °C

Max temp (day)20.8 °C

Min temp (night)11.7 °C

Precipitation115 mm/mo

Air humidity61.9 %

Moisture balance-10.9 mm/mo

Vapour deficit680 Pa

Wind speed2.40 m/s

Cloud cover44.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Callicladium imponens

At a glance

Sources6 archives

Habitat & environment1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type6 019 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 019 records