Callichilia barteri

(Hook.fil.) Stapf · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Callichilia

At a glance

Occurrence records261

Data sources10

Biological traits12

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Callichilia barteri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility261 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS15 compounds

Occurrence & distributionGBIF261 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Callichilia barteri grows as a shrub up to 3 m tall. Its fragrant flowers feature a white corolla. Fruit is yellow to orange with paired follicles, each up to 5 cm long. Habitat is in forests. Local medicinal uses include as a treatment for gonorrhoea and as an anthelmintic and childhood laxative. C. barteri is found in Togo, Benin, Nigeria, Cameroon, the Republic of Congo and the Democratic Republic of Congo.Search for "Callichilia barteri",

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height1.71 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition15 compounds

Compounds documented for Callichilia barteri across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aspidosperma type6

Iboga type5

Aspidosperma type $ Carboline alkaloids2

Aspidosperma type $ Aspidosperma-Iboga hybrid type (Vinca alkaloids)1

Corynanthe type1

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,12R,16S,22R)-6-methoxy-15-oxa-8,19-diazahexacyclo[10.9.1.01,9.02,7.012,16.019,22]docosa-2(7),3,5,8-tetraene	present	LOTUS
10-Methoxycoronaridine	present	LOTUS
6-Methoxy-15-oxa-8,19-diazahexacyclo[10.9.1.01,9.02,7.012,16.019,22]docosa-2(7),3,5-triene	present	LOTUS
Callichiline	present	LOTUS
methyl (1'S,3'S,12R,18S,21'R,22R,24'R,26'R)-18'-methoxyspiro[15-oxa-8,19-diazahexacyclo[10.9.1.01,9.02,7.012,16.019,22]docosa-2,4,6,9-tetraene-18,22'-6,25-dioxa-10,20-diazaoctacyclo[11.10.1.11,21.13,10.03,7.014,19.020,24.013,26]hexacosa-14(19),15,17-triene]-10-carboxylate	present	LOTUS
methyl (1R,1'R,7'S,11'R,12R,13'R,16S,17S,24'R,25'S)-24'-hydroxy-19'-methoxyspiro[15-oxa-8,19-diazahexacyclo[10.9.1.01,9.02,7.012,16.019,22]docosa-2,4,6,9-tetraene-17,15'-8-oxa-4,17-diazaheptacyclo[11.10.1.11,4.07,11.017,24.018,23.011,25]pentacosa-18(23),19,21-triene]-10-carboxylate	present	LOTUS
methyl (1R,10R,44R,45R)-25-methoxy-4,13-dioxa-17,27,30,40-tetrazatridecacyclo[28.13.1.110,17.01,5.06,29.08,28.010,14.020,28.021,26.033,41.033,44.034,39.020,45]pentatetraconta-21(26),22,24,34,36,38,41-heptaene-42-carboxylate	present	LOTUS
methyl (1R,11'R,12R,16S,17R,22R,24'S,25'R)-19'-methoxyspiro[15-oxa-8,19-diazahexacyclo[10.9.1.01,9.02,7.012,16.019,22]docosa-2,4,6,9-tetraene-17,15'-8-oxa-4,17-diazaheptacyclo[11.10.1.11,4.07,11.017,24.018,23.011,25]pentacosa-18(23),19,21-triene]-10-carboxylate	present	LOTUS
methyl (1R,11'R,12R,17S,22R,25'R)-19'-methoxyspiro[15-oxa-8,19-diazahexacyclo[10.9.1.01,9.02,7.012,16.019,22]docosa-2,4,6,9-tetraene-17,15'-8-oxa-4,17-diazaheptacyclo[11.10.1.11,4.07,11.017,24.018,23.011,25]pentacosa-13(24),18(23),19,21-tetraene]-10-carboxylate	present	LOTUS
methyl (1R,15R,17R)-17-ethyl-6-[(1S,12R,14R,15E)-15-ethylidene-18-methoxycarbonyl-17-methyl-10,17-diazatetracyclo[12.3.1.03,11.04,9]octadeca-3(11),4,6,8-tetraen-12-yl]-7-methoxy-3,13-diazapentacyclo[13.3.1.02,10.04,9.013,18]nonadeca-2(10),4,6,8-tetraene-1-carboxylate	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callichilia barteri has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKGU973894.1 ↗1 523 bpNetherlands

ACGT

TCCAAAGATATTTACAGCTTGATAGATCTCAACAACCCAGCTTTCTATATCCACTTATCTTTCAGGAATATATTTATGCACTTGCTCATG …

Callichilia barteri maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Callichilia barteri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Laan, F. M. v. d. & J. C. Arends. 1985. Cytotaxonomy of Apocynaceae. Genetica 68: 3–35.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type261 records

Wild obs. + sensor77

Museum / vouchered171

Other13

Range

Area of Occupancy AOO572 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 6

6 georeferenced · 71 without coordinates

Open the mapobservation + sensor77

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 170 without coordinates

Open the institutions mapphysical evidence171

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
HNBlocation not on record	36
Yaoundé, CM	20
Saint Louis, US	10
Kew, GB	9
LSF/FSA/UAClocation not on record	5
Université du Lomélocation not on record	5
LSFlocation not on record	4
BRLUlocation not on record	4
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	2
Plocation not on record	1
WAGlocation not on record	1

11 institutions · 97 of 171 vouchered records shown · 73 without an institution code

09Environmental DNA1 detections

Where the DNA of Callichilia barteri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C 10.1–10.1

Seasonal swing summer↔winter15.0 °C

Max temp (day)13.4 °C

Min temp (night)6.70 °C

Precipitation73.8 mm/mo

Air humidity63.8 %

Moisture balance-1.10 mm/mo

Vapour deficit487 Pa

Wind speed5.10 m/s

Cloud cover44.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)