Callicarpa shikokiana

Makino · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Callicarpa

At a glance

Occurrence records68

Data sources7

Biological traits11

DNA specimens3

eDNA detections1

Sources7 archives

Databases and archives Callicarpa shikokiana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF68 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Callicarpa shikokiana, commonly called Shikoku beautyberry or China beautyberry, is a plant species in the Lamiaceae and is native to China. It is a shrub with pink flowers in summer and purple fruit in the fall. The berry-like fruit is a drupe. It is cultivated in home gardens and national parks as an ornamental plant. The leaves turn yellow in the fall.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction4

Deciduousnessdeciduous

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Shrub (S)

Woodinesswoody

Physiology & chemistry1

Specific leaf area (SLA)18.83 mm²/mg

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callicarpa shikokiana has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLLC694571.1 ↗531 bpJapan · 2010

ACGT

ATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTA …

Callicarpa shikokiana TF<JPN>:YSR_27 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1trnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type68 records

Wild obs. + sensor1

Museum / vouchered67

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤1 km 7≤10 km 41

48 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	41
FFPRIlocation not on record	5
Kochi, JP	5
Sanda, JP	5
Columbia, US	3
Nishihara, JP	2
Forestry and Forest Products Research Institutelocation not on record	1
Auckland, NZ	1
Taipei, TW	1

9 institutions · 64 of 67 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Callicarpa shikokiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 23.2–23.2

Seasonal swing summer↔winter14.1 °C

Max temp (day)24.1 °C

Min temp (night)22.2 °C

Precipitation224 mm/mo

Air humidity56.0 %

Vapour deficit1,248 Pa

Cloud cover29.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)