Callicarpa nudiflora

Hook. & Arn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Callicarpa

At a glance

Occurrence records207

Data sources14

Biological traits25

DNA specimens17

eDNA detections8

Sources14 archives

Databases and archives Callicarpa nudiflora's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility207 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Chemical compositionLOTUS · NPASS11 compounds

Occurrence & distributionGBIF207 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI17 specimens

Genome at a glanceCCDB · GoaT · NCBI≈597 Mbp

01Narrative

Callicarpa nudiflora is a species of beautyberry that is grown as an ornamental plant. It is native to Southeast Asia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Leaf size3 250 mm²

Plant height7 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Leaf formovate

Woodinesswoody

Physiology & chemistry6

Leaf c489 mg/g

Leaf dry-matter content (LDMC)361 mg/g

Leaf n20.27 mg/g

Leaf p1.47 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)15.4 mm²/mg

⚠ sources differ — TRY: 15.4 mm²/mg · GIFT: 17.94 mm²/mg

Other traits6

Leaf marginfinely toothed

Leaf spinesno

Leaf thornsno

Plant support typefree-standing

Sla max20.32 mm²/mg

Sla min15.55 mm²/mg

03Chemical composition11 compounds

Compounds documented for Callicarpa nudiflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Monomeric stilbenes2

Flavanones2

Flavones2

Flavonols2

Cinnamic acids and derivatives $ Phenylethanoids1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3S)-2-(3,4-dimethoxyphenyl)-5,7-dihydroxy-3-methoxy-2,3-dihydrochromen-4-one	present	LOTUS
(2S)-5-hydroxy-7-methoxy-6-(3-methylbut-2-enyl)-2-phenyl-2,3-dihydrochromen-4-one	present	NPASS
1,3-dimethoxy-2-(3-methylbut-2-enyl)-5-[(E)-2-phenylethenyl]benzene	present	NPASS
3,5-Dimethoxy-4-prenylstilbene	present	NPASS
6-Prenylpinocembrin	present	NPASS
Apigenin	present	LOTUS
Ayanin	present	LOTUS
gamma-Sitosterol	present	LOTUS
Luteolin 7-diglucoside	present	LOTUS
Quercetin	present	LOTUS

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callicarpa nudiflora has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes6

GenBank sequences10

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKC441017.1 ↗452 bp

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Callicarpa nudiflora voucher HPS12100130 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★rbcLa★ITS5★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Callicarpa nudiflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈596 539 594 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Callicarpa nudiflora0.60 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 341×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Mehra, P.N. & Bawa, K.S. 1969

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type207 records

Wild obs. + sensor17

Museum / vouchered190

Range

Area of Occupancy AOO376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 6≤1 km 5≤10 km 2

13 georeferenced · 4 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 2

3 georeferenced · 187 without coordinates

Open the institutions mapphysical evidence190

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	61
Beijing, CN	30
Guilin, CN	28
Nanjing, CN	12
Guangzhou, CN	8
Changsha, CN	6
Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record	5
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	4
Chengdu, CN	4
Istituto Agrario Castelnuovolocation not on record	3
Hangzhou, CN	3
Zhengzhou, CN	3
Kew, GB	2
Wuhan, CN	2
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	2
Jishou Universitylocation not on record	1
UNESP-IBILCElocation not on record	1
Vancouver, CA	1
Xiamen, CN	1
Minia, EG	1
Yangling, CN	1
Bronx, US	1
Yunnan Universitylocation not on record	1
Nagasaki University - Fisherieslocation not on record	1
Chengdu, CN	1
UNESP-RClocation not on record	1
Edinburgh, GB	1
South Kensington, GB	1
Cincinnati, US	1

29 institutions · 187 of 190 vouchered records shown · 3 without an institution code

09Environmental DNA8 detections

Where the DNA of Callicarpa nudiflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 24.1–24.1

Seasonal swing summer↔winter21.2 °C

Max temp (day)30.7 °C

Min temp (night)17.6 °C

Precipitation15.4 mm/mo

Air humidity50.5 %

Moisture balance-100 mm/mo

Vapour deficit1,477 Pa

Wind speed1.90 m/s

Cloud cover21.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)