Callicarpa macrophylla

Vahl · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Callicarpa

At a glance

Occurrence records303

Data sources13

Biological traits25

DNA specimens10

eDNA detections9

Sources13 archives

Databases and archives Callicarpa macrophylla's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility303 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Chemical compositionLOTUS · NPASS58 compounds

Occurrence & distributionGBIF303 records

Environmental DNA1 datasets · 3 countries9 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Callicarpa macrophylla is a species of beautyberry native to the Indian subcontinent. Its fruits are small white drupes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Leaf size9 849 mm²

Plant height2.5 m

⚠ sources differ — GIFT: 2.5 m · TRY: 5 m

Life cycle & reproduction6

Deciduousnessdeciduous

Life formshrub or tree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max600 m

Elevation min300 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry7

Leaf dry-matter content (LDMC)298 mg/g

Leaf n24.39 mg/g

Leaf p0.758 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)26.37 mm²/mg

Wood density359 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition58 compounds

Compounds documented for Callicarpa macrophylla across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cinnamic acids and derivatives $ Phenylethanoids15

Kaurane and Phyllocladane diterpenoids6

Cinnamic acids and derivatives4

Pimarane and Isopimarane diterpenoids4

Podocarpane diterpenoids4

Documented compounds58 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Codonopsine	present	NPASS
(1'R,4R,4'R,9'R,10'S,13'S)-2,2,5',5',9'-pentamethylspiro[1,3-dioxolane-4,14'-tetracyclo[11.2.1.01,10.04,9]hexadecane]-6'-one	present	LOTUS
(1R,1'S,4aS,5'S,6S,8aR)-1,4a-dimethyl-5-oxo-1'-propan-2-ylspiro[2,3,4,7,8,8a-hexahydronaphthalene-6,4'-6-oxabicyclo[3.1.0]hexane]-1-carboxylic acid	present	LOTUS
(1R,4aR,4bR,7R,8S,10aR)-7-ethenyl-8-hydroxy-1,4a,7-trimethyl-3,4,4b,5,6,8,10,10a-octahydro-2H-phenanthrene-1-carboxylic acid	present	LOTUS
(1R,4S,9S,10R,13R,14S)-14-hydroxy-14-(hydroxymethyl)-5,5,9-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecan-6-one	present	LOTUS
(1S,2R,4aR,4bS,8R,8aR)-2-ethenyl-8-(hydroxymethyl)-2,4b,8-trimethyl-3,4,4a,5,6,7,8a,9-octahydro-1H-phenanthren-1-ol	present	LOTUS
(1S,2R,6S,7S,9S,12R)-9-hydroxy-2,6-dimethyl-12-propan-2-yl-13,14-dioxatetracyclo[10.2.2.01,10.02,7]hexadec-10-ene-6-carboxylic acid	present	LOTUS
(1S,4R,9R,10R,13S,14R)-14-hydroxy-14-(hydroxymethyl)-5,5,9-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecan-11-one	present	LOTUS
2-(((3,4-dihydroxy-4-(hydroxymethyl)tetrahydrofuran-2-yl)oxy)methyl)-6-(3,4-dihydroxyphenethoxy)-5-hydroxy-4-((3,4,5-trihydroxy-6-methyltetrahydro-2H-pyran-2-yl)oxy)tetrahydro-2H-pyran-3-yl (E)-3-(3,4-dihydroxyphenyl)acrylate	present	LOTUS
2-Acetylacteoside	present	NPASS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callicarpa macrophylla has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences8

eDNA detections9

Countries3

The DNA barcodea real sequence read deposited for this species

ITSON820142.1 ↗663 bp

ACGT

TGTCGAGACCCGCAAAGCAGACCGCGAACACGTGTTTAACCACATCGGGCTCGCGGCGCGGGGGGGAAGCCTCCCGTCGTCGCGATCCCA …

Callicarpa macrophylla clone 38168 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Callicarpa macrophylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidypolyploid inferred

Chromosome records34–342n range34median34mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 343×CCDB · book-indian_vol1 · CCDB · Cave1963

CCDB · book-indian_vol1 — Sharma, A.K. & Mukhopadhyay, S. 1963b

CCDB · book-indian_vol1 — Sharma, A.K. & Mukhopadhyay, S. 1961

CCDB · Cave1963 — Sharma & Muk. 1963b

n 171×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Hehr a 1976

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type303 records

Wild obs. + sensor16

Museum / vouchered272

Other15

Range

Area of Occupancy AOO628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 2≤1 km 6≤10 km 2>10 km 3

13 georeferenced · 3 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1>10 km 2

3 georeferenced · 269 without coordinates

Open the institutions mapphysical evidence272

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	60
Guangzhou, CN	42
Guilin, CN	26
Herbarium of the Department of Botany, University of Tokyolocation not on record	21
Yangling, CN	11
Guiyang, CN	11
Nanjing, CN	10
Yunnan Universitylocation not on record	10
Central China Normal Universitylocation not on record	5
Guizhou Forestry Schoollocation not on record	5
Dehra Dun, IN	4
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	4
SMMUlocation not on record	3
Zhuzhou, CN	3
Guangzhou, CN	3
Kew, GB	3
Cambridge, US	2
Edinburgh, GB	2
Natural History Museum, Tribhuvan Universitylocation not on record	2
University of Stellenboschlocation not on record	2
Moscow State Universitylocation not on record	2
Saint Louis, US	2
黔东南州民族医药研究所标本室location not on record	2
Kunming, CN	2
Bronx, US	2
Chengdu, CN	2
Paris, FR	1
Guiyang, CN	1
Sri Ramaswamy Memorial Universitylocation not on record	1
Nanjing, CN	1
Beijing, CN	1
Guangxi Medicinal Botanic Gardenlocation not on record	1
Southwest Forestry Collegelocation not on record	1
MeiseBGlocation not on record	1
Hangzhou, CN	1
Guiyang, CN	1
Seoul, KR	1
Berlin, DE	1
Durban, ZA	1
Taipei, TW	1
Herbarium of South China Botanical Gardenlocation not on record	1
Muzaffarabad, PK	1
Baroda, IN	1
Fort Worth, US	1

44 institutions · 259 of 272 vouchered records shown · 10 without an institution code

09Environmental DNA9 detections

Where the DNA of Callicarpa macrophylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 12.3–28.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 16.8–31.9

Min temp (night)19.3 °C 6.60–23.6

Precipitation137 mm/mo 51.8–282

Air humidity59.8 % 48.2–66.1

Moisture balance-8.90 mm/mo -64.2–167

Vapour deficit1,523 Pa 648–1,579

Wind speed2.20 m/s 2.00–4.20

Cloud cover38.6 % 24.6–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)