Callicarpa kwangtungensis

Chun · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Callicarpa

At a glance

Occurrence records399

Data sources8

Biological traits8

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Callicarpa kwangtungensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility399 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Chemical compositionLOTUS · NPASS18 compounds

Occurrence & distributionGBIF399 records

DNA & barcodingNCBIsequences

01Narrative

Callicarpa kwangtungensis is a species of beautyberry. The tree is introduced in Europe as an ornamental plant. The fruit is light-pink and grows in small clusters. The flowers can range from pink to white. It is endemic to China. The berries are very bitter and inedible for human use. Birds and other wild life won't eat them unless all their food sources are depleted.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Woodinesswoody

03Chemical composition18 compounds

Compounds documented for Callicarpa kwangtungensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Cinnamic acids and derivatives $ Phenylethanoids13

Flavonols2

Hydroxy fatty acids1

Phenylethanoids1

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
2'-O-Acetylpoliumoside	present	LOTUS
2-(((3,4-dihydroxy-4-(hydroxymethyl)tetrahydrofuran-2-yl)oxy)methyl)-6-(3,4-dihydroxyphenethoxy)-5-hydroxy-4-((3,4,5-trihydroxy-6-methyltetrahydro-2H-pyran-2-yl)oxy)tetrahydro-2H-pyran-3-yl (E)-3-(3,4-dihydroxyphenyl)acrylate	present	NPASS
2-Acetylacteoside	present	LOTUS
[(2R,3R,4R,5R,6R)-2-[[(2R,3R,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxymethyl]-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-4-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] (E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoate	present	NPASS
[(2R,3R,4R,5R,6R)-2-[[3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxymethyl]-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-4-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] (E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoate	present	NPASS
[(2R,3R,5R,6R)-5-acetyloxy-6-[2-(3,4-dihydroxyphenyl)ethoxy]-2-(hydroxymethyl)-4-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	LOTUS
Alyssonoside	present	NPASS
citrate	present	NPASS
Decaffeoyl-acteoside	present	NPASS
Echinacoside	present	NPASS

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callicarpa kwangtungensis has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOM333853.1 ↗760 bp

ACGT

CGACGTCGTGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCAT …

Callicarpa kwangtungensis isolate MZH73 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type399 records

Museum / vouchered399

Range

Area of Occupancy AOO596 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 397 without coordinates

Open the institutions mapphysical evidence399

10Collections & institutions

Holding institutions18 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	91
Guangzhou, CN	67
Changsha, CN	66
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	45
Guilin, CN	37
Nanjing, CN	22
Jishou Universitylocation not on record	12
Yangling, CN	9
Zhuzhou, CN	9
Guizhou Forestry Schoollocation not on record	9
Jiangxi College of Traditional Chinese Medicinelocation not on record	3
Taipei, TW	3
Guiyang, CN	3
Chengdu, CN	3
Central China Normal Universitylocation not on record	2
WNNUlocation not on record	2
Fujian Institute of Subtropical Botanylocation not on record	2
Columbia, US	1
Kunming, CN	1
Clemson, US	1
Wuhan, CN	1
Jiujiang Forestry Institutelocation not on record	1
Zhejiang Universitylocation not on record	1
Guangzhou, CN	1
Hanshan Normal Universitylocation not on record	1
Seoul, KR	1
Guiyang, CN	1
Xiamen, CN	1
LDlocation not on record	1

29 institutions · 397 of 399 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)