Callianthe picta

(Gillies ex Hook. & Arn.) Donnell · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Callianthe

At a glance

Occurrence records1 897

Data sources10

Biological traits20

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Callianthe picta's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 897 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF1 897 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Abutilon pictum, syn. Abutilon striatum (disputed), is a species of flowering plant in the family Malvaceae. It is native to southern Brazil, Argentina, Paraguay and Uruguay. The plant has become naturalised in Central America, and is used in horticulture. Common names include redvein abutilon, red vein Indian mallow, redvein flowering maple, Chinese-lantern and red vein Chinese lanterns.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology4

Leaf length100 mm

Leaf width65 mm

Plant height5 m

Plant height max5 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Fruit typemericarp

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree · TRY: Shrub

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition1 compounds

Compounds documented for Callianthe picta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cadinane sesquiterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Gossypol		present	LOTUS

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callianthe picta has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOP711154.1 ↗551 bpMexico

ACGT

GTTAAAGAGTATAAATTGACTTATTATACTCCGGAATATGAAGTCAAAGATACTGATATCTTGGCAGCCTTCCGAGTAAGTCCCCAACCC …

Callianthe picta voucher Anastacio Sotero 20556 (MEXU, US) ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Callianthe picta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 167×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Krishnappa, D. G. & Munirajappa. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 582–583.

CCDB · ipcn-api-dl — Krishnappa, D. G. & Munirajappa. 1983. Polyploidy in the speciation of the genus Abutilon. Proc. Indian Sci. Congr. Assoc. 70(3–VI): 89–90.

CCDB · ipcn-api-dl — Fernández, A. 1981. Recuentos cromosómicos en Malvales. Bonplandia (Corrientes) 5(10): 63–71.

CCDB · ipcn-api-dl — Munirajappa & D. G. Krishnappa. 1993. Cytotaxonomic studies in some south Indian species of Abutilon. J. Cytol. Genet. 28: 71–76.

CCDB · book-indian_vol1 — Kuhn (Tischler, G. 1931) ; Davie, J.H. 1933 ; Skovsted, A. 1935

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 897 records

Wild obs. + sensor1 816

Museum / vouchered81

Range

Area of Occupancy AOO4 404 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 008≤1 km 288≤10 km 124>10 km 66

1 486 georeferenced · 330 without coordinates

Open the mapobservation + sensor1 816

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤1 km 4≤10 km 4>10 km 1

9 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Jose State University, Museum of Birds and Mammalslocation not on record	34
Blumenau, BR	8
University of Stellenboschlocation not on record	5
Pontificia Universidad Javeriana (PUJ)location not on record	4
Christchurch, NZ	4
Guatemala City, GT	3
Universidad de Caldas (UCaldas)location not on record	2
Saint Louis, US	2
Valparaiso, CL	2
Lake Charles, US	2
Dekalb, US	1
Mexico City, MX	1
Ivano-Frankivsk, UA	1
La Paz, BO	1
Bronx, US	1
Universidade Federal de Santa Catarinalocation not on record	1
Foz do Iguaçu, BR	1
Corrientes, AR	1
BIO-UNIPIlocation not on record	1
Sendai, JP	1
Austin, US	1
UNESP-FCAlocation not on record	1
PUC-RSlocation not on record	1
Universidade Federale do Rio Grande do Sullocation not on record	1
UFSClocation not on record	1

25 institutions · 81 of 81 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Callianthe picta

At a glance

Sources10 archives

Size & morphology4

Life cycle & reproduction4

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Compound class profile1 class

Documented compounds1 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 897 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 25 geolocated

Record type1 897 records