Callianthe darwinii

(Hook.fil.) Donnell · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Callianthe

At a glance

Occurrence records10

Data sources7

Biological traits10

DNA specimens0

eDNA detections1

Sources7 archives

Databases and archives Callianthe darwinii's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF10 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Callianthe darwinii is a shrub typically growing 2 m tall, native to Brazil (South America). The flowers are pink.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Habitat GIFTFloresta Ombrófila (= Floresta Pluvial)

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Callianthe darwinii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKX783812.1 ↗552 bpEgypt · 2012

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGAGTATAAATTGACTTATTATACTCCGGAATATGAAGTCAAAGAGACTGATATCTTGGCAGCC …

Callianthe darwinii voucher Hosam00248 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type10 records

Wild obs. + sensor1

Museum / vouchered9

Origin

Native4

Range

Area of Occupancy AOO32 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Blumenau, BR	4
UDESC-CAVlocation not on record	1
Cascavel, BR	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Lake Charles, US	1

5 institutions · 8 of 9 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Callianthe darwinii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 16.5–16.5

Seasonal swing summer↔winter13.8 °C

Max temp (day)22.7 °C

Min temp (night)10.0 °C

Precipitation7.80 mm/mo

Air humidity54.6 %

Moisture balance-108 mm/mo

Vapour deficit852 Pa

Wind speed3.50 m/s

Cloud cover28.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)