Calliandra riparia

Pittier · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Calliandra

At a glance

Occurrence records172

Data sources7

Biological traits12

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Calliandra riparia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility172 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF172 records

DNA & barcodingNCBIsequences

01Narrative

Calliandra riparia is a species of flowering plants of the genus Calliandra in the family Fabaceae. It is native to Panama, Colombia, Guyana, and Venezuela

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height6 m

Life cycle & reproduction1

Life formshrub or tree

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 330 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Wood density800 mg/cm³

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calliandra riparia has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJX870735.1 ↗712 bp

ACGT

ACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTG …

Calliandra riparia isolate FS1149 (LAMOL) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type172 records

Wild obs. + sensor22

Museum / vouchered150

Range

Area of Occupancy AOO496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 8≤1 km 1≤10 km 1>10 km 4

14 georeferenced · 8 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤1 km 6≤10 km 8>10 km 2

16 georeferenced · 134 without coordinates

Open the institutions mapphysical evidence150

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	62
Bronx, US	19
Universidad Nacional de Colombia (UNAL)location not on record	9
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	8
Universidad de Antioquia (UdeA)location not on record	6
COLlocation not on record	6
Kew, GB	5
University of Stellenboschlocation not on record	4
National Biodiversity Institute, Costa Ricalocation not on record	4
Chicago, US	3
León, NI	3
Feira de Santana, BR	2
Laboratorio de Ictiologialocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Universidade Federal do Rio Grande do Nortelocation not on record	2
Managua, NI	2
CEPLAClocation not on record	1
EL PASO, US	1
MeiseBGlocation not on record	1
JBRJlocation not on record	1
Brasília, BR	1
CUVClocation not on record	1
Antiguo Cuscatlán, SV	1
Provincial Museum of Albertalocation not on record	1
Denver, US	1
Universidad Nacional Federico Villarreallocation not on record	1
Universidad de Pamplona (UPamplona)location not on record	1

27 institutions · 150 of 150 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)