Calla palustris
speciesAt a glance
Occurrence records71 464
Data sources15
Biological traits41
DNA specimens26
eDNA detections17
Sources15 archives
Databases and archives Calla palustris's data was compiled from.
WikipediaWikimedia Foundation16 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility71 464 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics26 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources41 traits
Chemical compositionLOTUS2 compounds
Occurrence & distributionGBIF71 464 records
Environmental DNA1 datasets · 5 countries17 detections
DNA & barcodingBOLD · NCBI26 specimens
Genome at a glanceCCDB · GoaT1.1 Gbp
01Narrative
Calla (bog arum, marsh calla, wild calla, squaw claw, and water-arumDickinson, T.; Metsger, D.; Bull, J.; & Dickinson, R. (2004) ROM Field Guide to Wildflowers of Ontario. Toronto:Royal Ontario Museum, p. 62.) is a genus of flowering plant in the family Araceae, containing the single species Calla palustris.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass379 mg
Leaf size11 713 mm²
Plant height0.15 m
⚠ sources differ — GIFT: 0.15 m · LEDA: 0.15 m · TRY: 0.283 m
Plant height generative0.225 m
Plant height max0.3 m
Plant height min0.15 m
Seed length4.08 mm
Seed mass2.65 mg
⚠ sources differ — TRY: 2.65 mg · LEDA: 2.73 mg · GIFT: 2.16 mg
Seed mass max2.69 mg
Seed mass min0.48 mg
Life cycle & reproduction13
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typewater
Flowering endJun
Flowering startMay
Life formsemiaquatic subshrub
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
Reproduction asexualabsent
Seed number198
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typeberry
Growth formherb
Habitat GIFTlakes, meadows: wet, rivers, swamps
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry6
Leaf c441 mg/g
Leaf dry-matter content (LDMC)121 mg/g
⚠ sources differ — TRY: 121 mg/g · LEDA: 106 mg/g
Leaf n42.35 mg/g
Leaf p0.8 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)30.21 mm²/mg
⚠ sources differ — TRY: 30.21 mm²/mg · LEDA: 30.21 mm²/mg · GIFT: 31.95 mm²/mg
Other traits1
Diaspore typegerminule
03Chemical composition2 compounds
Compounds documented for Calla palustris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Carbocyclic fatty acids2
Documented compounds2 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 13-Phenyltridecanoic acid | present | LOTUS | |
| 15-Phenylpentadecanoic acid | present | LOTUS |
05DNA & barcoding26 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Calla palustris has left across the world's sequence archives.
At a glance
DNA specimens26
Marker genes4
GenBank sequences10
eDNA detections17
Countries6
The DNA barcodea real sequence read deposited for this species
AAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAGGATACTGATATCTTG …
Calla palustris ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL6★rbcLa★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Calla palustris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 134 480 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Calla palustris1.13 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy8× octoploid · measured
Chromosome records36–722n range36median36mode35records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3619×CCDB · iapt · CCDB · fl-europaea · CCDB · book-ipcn65 +3
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · fl-europaea — Wulff, 1939
CCDB · book-ipcn65 — Love & Love 1965b
CCDB · ipcn-api-dl — Sokolovskaya, A. P. & N. S. Probatova. 1985. Chromosome numbers in the vascular plants from the Primorye territory, Kamchatka, region, Amur valley and Sakhalin. Bot. Zhurn. SSSR 70(7): 997–999.
CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.
CCDB · ipcn-api-dl — KARTASHOVA, N. N., L. A. MALAKHOVA & A. A. KOZLOVA. 1974. Study of the chromosomes of the representatives of the Ob region flora. I. Number of chromosomes of the Tomsk district. Naucn. Dokl. Vyss. Shkoly, Biol. Nauki 4: 114–119.
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & S. A. Shatalova. 2001. Chromosome numbers in some plant species from the environs of Vladivostok city (Primorsky Region). Bot. Žhurn. (Moscow & Leningrad) 86(1): 168–172.
CCDB · ipcn-api-dl — Shatalova, S. A. 2000. Chromosome numbers in vascular plants of the Primorsky territory. Bot. Žhurn. (Moscow & Leningrad) 85(1): 152–156.
CCDB · ipcn-api-dl — Probatova. 2006. Chromosome numbers of some plant species of the Primkorsky Territory and the Amur River basin. Bot. Žhurn. (Moscow & Leningrad) 91(5): 785–804.
CCDB · ipcn-api-dl — Probatova. 2003. The chromosome numbers as a source of information in studies of the Russian Far East flora. Bull. Far E. Branch Russ. Acad. Sci. 3: 54–67.
CCDB · ipcn-api-dl — Probatova. 2006. Further chromosome studies on vascular plant species from Sakhalin, Moneron and Kurile Islands. Biodivers. Biogeogr. Kuril Islands Sakhalin 2: 93–110.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981b. In Chromosome number reports LXXII. Taxon 30: 699–701.
CCDB · eflora
CCDB · book-fedorov — Dudley 1937
CCDB · book-fedorov — Wulff 1939a
CCDB · book-fedorov — Love A.. Love D.
CCDB · book-fedorov — C. n. III. 1965)
CCDB · iapt — IAPT/IOPB Chromosome Data 17
2n 7215×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · iapt +6
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · fl-europaea — LOve & LoVe, 1944
CCDB · poland — Wcis?o H. 1970. Karyological studies in Polish representatives of Spadiciflorae. Acta Biol. Cracov. Ser. Bot. 13, 79-88.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chromosome numbers in some species of vascular plants from Byelorussia. Bot. Zhurn. SSSR 71: 1145–1147.
CCDB · ipcn-api-dl — Geber, G. & D. Schweizer. 1988. Cytochemical heterochromatin differentiation in Sinapis alba (Cruciferae) using a simple air-drying technique for producing chromosome spreads. Pl. Syst. Evol. 158: 97–106.
CCDB · ipcn-api-dl — Dvo|3rák, F. 1989. Chromosome counts and chromosome morphology of some selected species. Scripta Fac. Sci. Nat. Univ. Purkyn. Brun. 19: 301–322.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — HINDAKOVA, M. 1976. In Index of chromosome numbers of Slovakian flora. Part 5. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.
CCDB · book-ipcn67-71 — WCISLO, H. 1970. Karylogical studies in Polish representatives of spadiciflorae. Acta Biol. Cracov . ser. Bot. 13: 1-14.
CCDB · book-ipcn67-71 — MARCHANT, C.J. 1970. Chromosome variation in Araceae: I. Pothoeae to Stylochitoneae. Kew Bull. 24: 315-322.
CCDB · book-ipcn73-74 — GADELLA, T.W.J., & E. KLIPHUIS. 1973. Chromosome numbers of flowerinl plants in the Netherlands VI. Proc. Kon. Ned. Acad. Wet., ser. C 76: 303-311.
CCDB · book-fedorov — LOve A., Love D. 1944h
CCDB · book-fedorov — Tarnavschi 1948
2n 601×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — UOTILA, P. & K. Pellinen. 1985. Chromosome numbers in vascular plants from Finland. Acta Bot. Fenn. 130.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
octoploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=0.996 ↗
08Occurrence & distribution
Record type71 464 records
Wild obs. + sensor63 273
Museum / vouchered8 050
Cultivated / captive21
Fossil3
Other117
Origin
Native7
Introduced111
Range
Area of Occupancy AOO137 796 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy76% within 1 km
≤100 m 24 949≤1 km 17 262≤10 km 11 626>10 km 1 510
55 347 georeferenced · 7 926 without coordinates
Open the mapobservation + sensor63 273
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 349≤1 km 1 746≤10 km 2 635>10 km 762
5 492 georeferenced · 2 558 without coordinates
Open the institutions mapphysical evidence8 050
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 7>10 km 7
14 georeferenced · 7 without coordinates
Open the mapnot free-living21
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions101 of 189 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 521 |
| Helsinki, FI | 448 |
| Olocation not on record | 343 |
| Moscow State Universitylocation not on record | 325 |
| LDlocation not on record | 291 |
| Kuopio, FI | 256 |
| Madison, US | 223 |
| St. Paul, US | 209 |
| Philadelphia, US | 191 |
| BFLlocation not on record | 172 |
| Uppsala, SE | 170 |
| Brussel, BE | 146 |
| Chongqing Museumlocation not on record | 140 |
| Oulu, FI | 122 |
| MeiseBGlocation not on record | 121 |
| Oskarshamn, SE | 117 |
| Toronto, CA | 96 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 88 |
| Tartu, EE | 84 |
| Université Lavallocation not on record | 82 |
| Québec, CA | 82 |
| Jyväskylä, FI | 82 |
| Adam Mickiewicz University in Poznańlocation not on record | 79 |
| Turku, FI | 77 |
| Chicago, US | 77 |
| Acadia Universitylocation not on record | 71 |
| University of New Hampshirelocation not on record | 69 |
| Burlington, US | 67 |
| Ann Arbor, US | 64 |
| Irkutsk State Universitylocation not on record | 59 |
| SLU Artdatabankenlocation not on record | 59 |
| Green Bay, US | 58 |
| LfUlocation not on record | 56 |
| KMNlocation not on record | 54 |
| Salzburg, AT | 52 |
| IFR-DNFlocation not on record | 48 |
| University of Alberta Museumslocation not on record | 45 |
| Tallinn, EE | 44 |
| Vancouver, CA | 44 |
| Trondheim, NO | 42 |
| Görlitz, DE | 40 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 39 |
| Institute of the biological problems of the North FEB RASlocation not on record | 38 |
| Montréal, CA | 37 |
| Bern, CH | 35 |
| Saint John, CA | 33 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 33 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 31 |
| TUR-Alocation not on record | 30 |
| New Haven, US | 30 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 29 |
| Porvoo, FI | 27 |
| Provincia di Livornolocation not on record | 26 |
| Bergen, NO | 26 |
| South Kensington, GB | 25 |
| WINlocation not on record | 22 |
| Cambridge, US | 22 |
| Allentown, US | 22 |
| Tsukuba, JP | 21 |
| GJOlocation not on record | 20 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 18 |
| University of Wisconsinlocation not on record | 17 |
| Whitewater, US | 13 |
| Keene State Universitylocation not on record | 13 |
| Rovaniemi, FI | 13 |
| Bloomington, US | 13 |
| Fort Worth, US | 11 |
| Victoria, CA | 11 |
| Dresden, DE | 11 |
| Saint Louis, US | 10 |
| Anchorage, US | 10 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 8 |
| Beijing, CN | 8 |
| Philadelphia, US | 8 |
| JP | 8 |
| Tampa, US | 8 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 8 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 7 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 7 |
| Bronx, US | 7 |
| ENTClocation not on record | 7 |
| BRNUlocation not on record | 6 |
| Whitehorse, CA | 6 |
| WTUlocation not on record | 6 |
| University of Stellenboschlocation not on record | 6 |
| Ypsilanti, US | 6 |
| Chicago, US | 6 |
| Metsähallituslocation not on record | 6 |
| University of Winnipeglocation not on record | 6 |
| CASlocation not on record | 6 |
| Yukon Universitylocation not on record | 5 |
| Provo, US | 5 |
| Mount Pleasant, US | 5 |
| University of Wisconsinlocation not on record | 5 |
| Millersville, US | 5 |
| TROMlocation not on record | 5 |
| McWane Science Centerlocation not on record | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Durham, US | 4 |
| Wlocation not on record | 4 |
| PRClocation not on record | 4 |
| NMBU:MINAlocation not on record | 4 |
| Pullman, US | 4 |
| College Park, US | 4 |
| Hamilton, US | 3 |
| IWEP FEB RASlocation not on record | 3 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 3 |
| Davenport, US | 3 |
| Logan, US | 3 |
| Moscow, US | 3 |
| Dekalb, US | 3 |
| University of Lethbridgelocation not on record | 3 |
| Mlocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Northeastern Forestry Universitylocation not on record | 3 |
| MAlocation not on record | 3 |
| Bangkok, TH | 3 |
| Boise, US | 3 |
| DBF-NHMDlocation not on record | 3 |
| 东北师范大学自然博物馆location not on record | 3 |
| Auckland, NZ | 2 |
| Chicago, US | 2 |
| Berlin, DE | 2 |
| Paris, FR | 2 |
| Dover, US | 2 |
| University of Hamburglocation not on record | 2 |
| Tula State Universitylocation not on record | 2 |
| Austin, US | 2 |
| Kyoto Universitylocation not on record | 2 |
| Columbia, US | 2 |
| Porrentruy, CH | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Chadron, US | 2 |
| Stockholm, SE | 2 |
| Karlsruhe, DE | 2 |
| Forssa, FI | 2 |
| Pittsburg, US | 2 |
| Tampere, FI | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| Kandalaksha State Nature Reservelocation not on record | 2 |
| Bourges, FR | 2 |
| Royal Botanic Garden Edinburghlocation not on record | 2 |
| US | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Staten Island, US | 2 |
| Tilburg, NL | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Cheney, US | 2 |
| UGentlocation not on record | 1 |
| Université de Bordeauxlocation not on record | 1 |
| WNNUlocation not on record | 1 |
| Flagstaff, US | 1 |
| Guangzhou, CN | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Nijmegen, NL | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Canadian Museum of Naturelocation not on record | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Xiamen, CN | 1 |
| Miami, US | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Cambridge, US | 1 |
| nbflocation not on record | 1 |
| SZUlocation not on record | 1 |
| Kew, GB | 1 |
| GZUlocation not on record | 1 |
| Pocatello, US | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Lincoln, US | 1 |
| Macomb, US | 1 |
| GB | 1 |
| Oswego, US | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| Salamanca, ES | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Cambridge, US | 1 |
| BClocation not on record | 1 |
| Podgorica, ME | 1 |
| Sevilla, ES | 1 |
| Sion, CH | 1 |
| Williamsburg, US | 1 |
| Barcelona, ES | 1 |
| H-Schuhwlocation not on record | 1 |
| Philadelphia, US | 1 |
189 institutions · 7 441 of 8 050 vouchered records shown · 489 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA17 detections
Where the DNA of Calla palustris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map5 countries0
lakePond edge
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.5 °C 3.20–17.4
Seasonal swing summer↔winter19.1 °C
Max temp (day)20.2 °C 6.00–22.0
Min temp (night)11.1 °C -1.40–13.4
Precipitation73.4 mm/mo 54.2–140
Air humidity60.0 % 55.2–61.7
Moisture balance-45.2 mm/mo -64.3–70.8
Vapour deficit740 Pa 352–878
Wind speed3.60 m/s 1.90–6.00
Cloud cover41.9 % 36.7–46.7
CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.